PLEKHA8-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 Gene View larger

PLEKHA8-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLEKHA8-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PLEKHA8-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002838
Product type: DNA & cDNA
Ncbi symbol: PLEKHA8
Origin species: Human
Product name: PLEKHA8-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 Gene
Size: 2ug
Accessions: BC002838
Gene id: 84725
Gene description: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8
Synonyms: FAPP2; pleckstrin homology domain-containing family A member 8; PH domain-containing family A member 8; phosphatidylinositol-four-phosphate adapter protein 2; phosphoinositol 4-phosphate adapter protein 2; pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8; serologically defined breast cancer antigen NY-BR-86; pleckstrin homology domain containing A8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagggggtgctgtacaagtggaccaactatctgagcggttggcagcctcgatggttccttctctgtgggggaatattgtcctattatgattctcctgaagatgcctggaaaggttgcaaagggagcatacaaatggcagtctgtgaaattcaagttcattctgtagataatacacgcatggacctgataatccctggggaacagtatttctacctgaaggccagaagtgtggctgaaagacagcggtggctggtggccctgggatcagccaaggcttgcctgactgacagtaggacccagaaggagaaagagtttgctgaaaacactgaaaacttgaaaaccaaaatgtcagaactaagactctactgtgacctccttgttcagcaagtagataaaacaaaagaagtgaccacaactggtgtgtccaattctgaggagggaattgatgtgggaactttgctgaaatcaacctgtaatacttttctgaagaccttggaagaatgcatgcagatcgcaaatgcagccttcacctctgagctgctctaccgcactccaccaggatcacctcagctggccatgctcaagtccagcaagatgaaacatcctattataccaattcataattcattggaaaggcaaatggagttgagcacttgtgaaaatggatctttaaatatggaaataaatggtgaggaagaaatcctaatgaaaaataagaattccttatatttgaaatctgcagagatagactgcagcatatcaagtgaggaaaatacagatgataatataacagtccaaggtgaaataaggaaggaagatggaatggaaaacctgaaaaatcatgacaataacttgactcagtctggatcagactcaagttgctctccggaatgcctctgggaggaaggcaaagaagttatcccaactttctttagtaccatgaacacaagctttagtgacattgaacttctggaagacagtggcattcccacagaagcattcttggcatcatgttatgctgtggttccagtattagacaaacttggccctacagtgtttgctcctgttaagatggatcttgttggaaatattaagaaagtaaatcagaagtatataaccaacaaagaagagtttaccactctccagaagatagtgctgcacgaagtggaggcggatgtagcccaggttaggaactcagcgactgaagccctcttgtggctgaagagaggtctcaaatttttgaagggatttttgacagaagtgaaaaatggggagaaggatatccagacagccctaagaaatccaacagaaaacacttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
- SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1
- ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
- ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2

Buy PLEKHA8-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 Gene now

Add to cart