Login to display prices
Login to display prices
RAPSN-receptor-associated protein of the synapse Gene View larger

RAPSN-receptor-associated protein of the synapse Gene

PTXBC004196

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAPSN-receptor-associated protein of the synapse Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAPSN-receptor-associated protein of the synapse Gene

Proteogenix catalog: PTXBC004196
Ncbi symbol: RAPSN
Product name: RAPSN-receptor-associated protein of the synapse Gene
Size: 2ug
Accessions: BC004196
Gene id: 5913
Gene description: receptor-associated protein of the synapse
Synonyms: CMS11; CMS4C; FADS; RNF205; 43 kDa receptor-associated protein of the synapse; 43 kda postsynaptic protein; RING finger protein 205; acetylcholine receptor-associated 43 kda protein; receptor associated protein of the synapse
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcaggaccagaccaagaagcagatcgagaaggggctccagctgtaccagtccaaccagacagagaaggcattgcaggtgtggacaaaggtgctggagaagagctcggacctcatggggcgcttccgcgtgctgggctgcctggtcacagcccactcggagatgggccgctacaaggagatgctgaagttcgctgtggtccagatcgacacggcccgggagctggaggatgccgacttcctcctggagagctacctgaacctggcacgcagcaacgagaagctgtgcgagtttcacaagaccatctcctactgcaagacctgccttgggctgcctggtaccagggcaggtgcccagctcggaggccaggtcagcctgagcatgggcaatgccttcctgggcctcagcgtcttccagaaggccctggagagcttcgagaaggccctgcgctatgcccacaacaatgatgacgccatgctcgagtgccgcgtgtgctgcagcctgggcagcttctatgcccaggtcaaggactacgagaaagccctgttcttcccctgcaaggcggcagagcttgtcaacaactatggcaaaggctggagcctgaagtaccgggccatgagccagtaccacatggccgtggcctatcgcctgctgggccgcctgggcagtgccatggagtgttgtgaggagtctatgaagatcgcgctgcagcacggggaccggccactgcaggcgctctgcctgctctgcttcgctgacatccaccggagccgtggggacctggagctgagccagctcaagctgcactgtctgagcgagagcatttaccgcagcaaagggctgcagcgggaactgcgggcgcacgttgtgaggttccacgagtgcgtggaggagacggagctctactgcggcctgtgcggcgagtccataggcgagaagaacagccggctgcaggccctaccttgctcccacatcttccacctcaggtgcctgcagaacaacgggacccggagctgtcccaactgccgccgctcatccatgaagcctggctttgtatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: