Login to display prices
Login to display prices
RFC4-replication factor C (activator 1) 4, 37kDa Gene View larger

RFC4-replication factor C (activator 1) 4, 37kDa Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RFC4-replication factor C (activator 1) 4, 37kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RFC4-replication factor C (activator 1) 4, 37kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017452
Product type: DNA & cDNA
Ncbi symbol: RFC4
Origin species: Human
Product name: RFC4-replication factor C (activator 1) 4, 37kDa Gene
Size: 2ug
Accessions: BC017452
Gene id: 5984
Gene description: replication factor C (activator 1) 4, 37kDa
Synonyms: RFC37; replication factor C subunit 4; A1 37 kDa subunit; RF-C 37 kDa subunit; RFC 37 kDa subunit; activator 1 37 kDa subunit; activator 1 subunit 4; replication factor C (activator 1) 4, 37kDa; replication factor C 37 kDa subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaagcatttcttaaaggtacatccatcagtactaaacccccgctgaccaaggatcgaggagtagctgccagtgcgggaagtagcggagagaacaagaaagccaaacccgttccctgggtggaaaaatatcgcccaaaatgtgtggatgaagttgctttccaggaagaagtggttgcagtgctgaaaaaatctttagaaggagcagatcttcctaatctcttgttttacggaccacctggaactggaaaaacatccactattttggcagcagctagagaactctttgggcctgaacttttccgattaagagttcttgagttaaatgcatctgatgaacgtggaatacaagtagttcgagagaaagtgaaaaattttgctcaattaactgtgtcaggaagtcgctcagatgggaagccgtgtccgccttttaagattgtgattctggatgaagcagattctatgacctcagctgctcaggcagctttaagacgtaccatggagaaggagtcgaaaaccacccgattctgtcttatctgtaactatgtcagtcgaataattgaacccctgacctctagatgttcaaaattccgcttcaagcctctgtcagataaaattcaacagcagcgattactagacattgccaagaaggaaaatgtcaaaattagtgatgagggaatagcttatcttgttaaagtgtcagaaggagacttaagaaaagccattacatttcttcaaagcgctactcgattaacaggtggaaaggagatcacagagaaagtgattacagacattgctggggtaataccagctgagaaaattgatggagtatttgctgcctgtcagagtggctcttttgacaaactagaagctgtggtcaaggatttaatagatgagggtcatgcagcaactcagctcgtcaatcaactccatgatgtggttgtagaaaataacttatctgataaacagaagtctattatcacagaaaaacttgccgaagttgacaaatgcctagcagatggtgctgatgaacatttgcaactcatcagcctttgtgcaactgtgatgcagcagttatctcagaattgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nuclear factor (erythroid-derived 2), 45kDa
- hydroxysteroid (17-beta) dehydrogenase 2
- lysophosphatidylcholine acyltransferase 1
- 2',3'-cyclic nucleotide 3' phosphodiesterase