LPCAT1-lysophosphatidylcholine acyltransferase 1 Gene View larger

LPCAT1-lysophosphatidylcholine acyltransferase 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LPCAT1-lysophosphatidylcholine acyltransferase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LPCAT1-lysophosphatidylcholine acyltransferase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020166
Product type: DNA & cDNA
Ncbi symbol: LPCAT1
Origin species: Human
Product name: LPCAT1-lysophosphatidylcholine acyltransferase 1 Gene
Size: 2ug
Accessions: BC020166
Gene id: 79888
Gene description: lysophosphatidylcholine acyltransferase 1
Synonyms: AGPAT10; AGPAT9; AYTL2; LPCAT-1; PFAAP3; lpcat; lysoPAFAT; lysophosphatidylcholine acyltransferase 1; 1-acylglycerophosphocholine O-acyltransferase; 1-alkylglycerophosphocholine O-acetyltransferase; LPC acyltransferase 1; acetyl-CoA:lyso-PAF acetyltransferase; acetyl-CoA:lyso-platelet-activating factor acetyltransferase; acyltransferase-like 2; lyso-PAF acetyltransferase; lysoPC acyltransferase 1; phosphonoformate immuno-associated protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgatgtcctccatcgtgatgaaggcagagagcagagacatcccgatctggggaactctgatccagtatatacggcctgtgttcgtgtcccggtcagaccaggattctcgcaggaaaacagtagaagaaatcaagagacgggcgcagtccaacggaaagtggccacagataatgatttttccagaaggaacttgtacaaacaggacctgcctaattaccttcaaacctggtgcattcatccctggagcgcccgtccagcctgtggttttacgatatccaaataaactggacaccatcacatggacgtggcaaggacctggagcgctggaaatcctgtggctcacgctgtgtcagtttcacaaccaagtggaaatcgagttccttcctgtgtacagcccttctgaggaggagaagaggaaccccgcgctgtatgccagcaacgtgcggcgagtcatggccgaggccttgggtgtctccgtgactgactacacgttcgaggactgccagctggccctggcggaaggacagctccgtctccccgctgacacttgccttttagaatttgccaggctcgtgcggggcctcgggctaaaaccagaaaagcttgaaaaagatctggacagatactcagaaagagccaggatgaagggaggagagaagataggtattgcggagtttgccgcctccctggaagtccccgtttctgacttgctggaagacatgttttcactgttcgacgagagcggcagcggcgaggtggacctgcgagagtgtgtggttgccctgtctgtcgtctgccggccggcccggaccctggacaccatccagctggctttcaagatgtacggagcgcaagaggacggcagcgtcggcgaaggtgacctgtcctgcatcctcaagacggccctgggggtggcagagctcaccgtgaccgacctattccgagccattgaccaagaggagaaggggaagatcacattcgctgacttccacaggtttgcagaaatgtaccctgccttcgcagaggaatacctgtacccggatcagacacatttcgaaagctgtgcagagacctcacctgcgccaatcccaaacggcttctgtgccgatttcagcccggaaaactcagacgctgggcggaagcctgttcgcaagaagctggattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 2',3'-cyclic nucleotide 3' phosphodiesterase
- isocitrate dehydrogenase 1 (NADP+), soluble
- heterogeneous nuclear ribonucleoprotein F
- farnesyl-diphosphate farnesyltransferase 1

Buy LPCAT1-lysophosphatidylcholine acyltransferase 1 Gene now

Add to cart