Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HDGF-hepatoma-derived growth factor (high-mobility group protein 1-like) Gene
PTXBC018991
New product
Data sheet of HDGF-hepatoma-derived growth factor (high-mobility group protein 1-like) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HDGF-hepatoma-derived growth factor (high-mobility group protein 1-like) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018991 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HDGF |
| Origin species: | Human |
| Product name: | HDGF-hepatoma-derived growth factor (high-mobility group protein 1-like) Gene |
| Size: | 2ug |
| Accessions: | BC018991 |
| Gene id: | 3068 |
| Gene description: | hepatoma-derived growth factor (high-mobility group protein 1-like) |
| Synonyms: | HMG1L2; hepatoma-derived growth factor; high mobility group protein 1-like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgcgatccaaccggcagaaggagtacaaatgcggggacctggtgttcgccaagatgaagggctacccacactggccggcccggattgacgagatgcctgaggctgccgtgaaatcaacagccaacaaataccaagtcttttttttcgggacccacgagacggcattcctgggccccaaagacctcttcccttacgaggaatccaaggagaagtttggcaagcccaacaagaggaaagggttcagcgaggggctgtgggagatcgaaaacaaccctactgtcaaggcttccggctatcagtcctcccagaaaaagagctgtgtggaagagcctgaaccagagcccgaagctgcagagggtgacggtgataagaaggggaatgcagagggcagcagcgacgaggaagggaagctggtcattgatgagccagccaaggagaagaacgagaaaggagcgttgaagaggagagcaggggacttgctggaggactctcctaaacgtcccaaggaggcagaaaaccctgaaggagaggagaaggaggcagccaccttggaggttgagaggccccttcctatggaggtggaaaagaatagcaccccctctgagcccggctctggccgggggcctccccaagaggaagaagaagaggaggatgaagaggaagaggctaccaaggaagatgctgaggccccaggcatcagagatcatgagagcctgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Src homology 3 domain-containing guanine nucleotide exchange factor - degenerative spermatocyte homolog 1, lipid desaturase (Drosophila) - eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa - methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like |