MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene View larger

MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008629
Product type: DNA & cDNA
Ncbi symbol: MTHFD1L
Origin species: Human
Product name: MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene
Size: 2ug
Accessions: BC008629
Gene id: 25902
Gene description: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Synonyms: FTHFSDC1; MTC1THFS; dJ292B18.2; monofunctional C1-tetrahydrofolate synthase, mitochondrial; 10-formyl-THF synthetase; formyltetrahydrofolate synthetase domain containing 1; methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggtgctggccctgacggacagcctcgcagacatgaaggcacggctgggaaggatggtggtggccagtgacaaaagcgggcagcctgtgacagcagatgatttgggggtgacaggtgctttgacagttttgatgaaagatgcaataaaaccaaacctgatgcagaccctggaagggacacctgtgttcgtgcatgcgggcccttttgctaacattgctcacggcaactcttcagtgttggctgataaaattgccctgaaactggttggtgaagaaggatttgtagtgaccgaagctggctttggtgctgacatcggaatggagaaattcttcaacatcaagtgccgagcttccggcttggtgcccaacgtggttgtgttagtggcaacggtgcgagctctgaagatgcatggaggcgggccaagtgtaacggctggtgttcctcttaagaaagaatatacagaggagaacatccagctggtggcagacggctgctgtaacctccagaagcaaattcagatcactcagctctttggggttcccgttgtggtggctctgaatgtcttcaagaccgacacccgcgctgagattgacttggtgtgtgagcttgcaaagcgggctggtgcctttgatgcagtcccctgctatcactggtcggttggtggaaaaggatcggtggacttggctcgggctgtgagagaggctgcgagtaaaagaagccgattccagttcctgtatgatgttcaggttccaattgtggacaagataaggaccattgctcaggctgtctatggagccaaagatattgaactctctcctgaggcacaagccaaaatagatcgttacactcaacagggttttggaaatttgcccatctgcatggcaaagacccacctttctctatctcaccaacctgacaaaaaaggtgtgccaagggacttcatcttacctatcagtgacgtccgggccagcataggcgctgggttcatttaccctttggtcggaacgatgagcaccatgccaggactgcccacccggccctgcttttatgacatagatcttgataccgaaacagaacaagttaaaggcttgttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
- COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)
- PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
- inositol 1,4,5-triphosphate receptor interacting protein-like 1

Buy MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene now

Add to cart