Login to display prices
Login to display prices
MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene View larger

MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene

PTXBC008629

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene

Proteogenix catalog: PTXBC008629
Ncbi symbol: MTHFD1L
Product name: MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene
Size: 2ug
Accessions: BC008629
Gene id: 25902
Gene description: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Synonyms: FTHFSDC1; MTC1THFS; dJ292B18.2; monofunctional C1-tetrahydrofolate synthase, mitochondrial; 10-formyl-THF synthetase; formyltetrahydrofolate synthetase domain containing 1; methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggtgctggccctgacggacagcctcgcagacatgaaggcacggctgggaaggatggtggtggccagtgacaaaagcgggcagcctgtgacagcagatgatttgggggtgacaggtgctttgacagttttgatgaaagatgcaataaaaccaaacctgatgcagaccctggaagggacacctgtgttcgtgcatgcgggcccttttgctaacattgctcacggcaactcttcagtgttggctgataaaattgccctgaaactggttggtgaagaaggatttgtagtgaccgaagctggctttggtgctgacatcggaatggagaaattcttcaacatcaagtgccgagcttccggcttggtgcccaacgtggttgtgttagtggcaacggtgcgagctctgaagatgcatggaggcgggccaagtgtaacggctggtgttcctcttaagaaagaatatacagaggagaacatccagctggtggcagacggctgctgtaacctccagaagcaaattcagatcactcagctctttggggttcccgttgtggtggctctgaatgtcttcaagaccgacacccgcgctgagattgacttggtgtgtgagcttgcaaagcgggctggtgcctttgatgcagtcccctgctatcactggtcggttggtggaaaaggatcggtggacttggctcgggctgtgagagaggctgcgagtaaaagaagccgattccagttcctgtatgatgttcaggttccaattgtggacaagataaggaccattgctcaggctgtctatggagccaaagatattgaactctctcctgaggcacaagccaaaatagatcgttacactcaacagggttttggaaatttgcccatctgcatggcaaagacccacctttctctatctcaccaacctgacaaaaaaggtgtgccaagggacttcatcttacctatcagtgacgtccgggccagcataggcgctgggttcatttaccctttggtcggaacgatgagcaccatgccaggactgcccacccggccctgcttttatgacatagatcttgataccgaaacagaacaagttaaaggcttgttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: