Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
COPS4-COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis) Gene
PTXBC004302
New product
Data sheet of COPS4-COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COPS4-COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004302 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COPS4 |
| Origin species: | Human |
| Product name: | COPS4-COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis) Gene |
| Size: | 2ug |
| Accessions: | BC004302 |
| Gene id: | 51138 |
| Gene description: | COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis) |
| Synonyms: | CSN4; SGN4; COP9 signalosome complex subunit 4; COP9 constitutive photomorphogenic homolog subunit 4; COP9 constitutive photomorphogenic-like protein subunit 4; JAB1-containing signalosome subunit 4; signalosome subunit 4; testis tissue sperm-binding protein Li 42a; COP9 signalosome subunit 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcagccgtgcgacaggatttggcccagctcatgaattcgagcggctctcataaagatctggctggcaagtatcgtcagatcctggaaaaagccattcagttatctggagcagaacaactagaagctttgaaagcttttgtggaagcaatggtaaatgagaatgtcagtctcgtgatctcgcggcagttgctgactgatttttgcacacatcttcctaacttgcctgatagcacagccaaagaaatctatcacttcaccttggaaaagatccagcctagagtcatttcatttgaggagcaggttgcttccataagacagcatcttgcatctatatatgagaaagaagaagattggagaaatgcagcccaagtgttggtgggaattcctttggaaacaggacaaaaacagtacaatgtagattataaactggagacttacttgaagattgctaggctatatctggaggatgatgatccagtccaggcagaggcttacataaatcgagcatcgttgcttcagaatgaatcaaccaatgaacaattacagatacattataaggtatgctatgcacgtgttcttgattatagaagaaaattcattgaagctgcacaaaggtacaatgagctctcttacaagacaatagtccacgaaagtgaaagactagaggccttaaaacatgctttgcactgtacgatcttagcatcagcagggcagcagcgttctcggatgctagctactctttttaaggatgaaaggtgccagcaacttgctgcctatgggatcctagagaaaatgtatctagataggatcatcagaggaaatcaacttcaagaatttgctgccatgctgatgcctcaccaaaaagcaactacagctgatggttccagcatcttggacagagctgttattgaacacaatttgttgtctgcaagcaaattatataataatattaccttcgaagaacttggagctcttttagagatccctgcagctaaggcggaaaagatagcatctcaaatgataaccgaaggacgtatgaatggatttattgaccagattgatggaatagttcattttgaaacacgagaagccctgccaacgtgggataagcagatccaatcactttgtttccaagtgaataaccttttggagaaaattagtcaaacagcaccagaatggacagcacaagccatggaagcccagatggctcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) - inositol 1,4,5-triphosphate receptor interacting protein-like 1 - NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa - translocase of inner mitochondrial membrane 17 homolog A (yeast) |