Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TIMM17A-translocase of inner mitochondrial membrane 17 homolog A (yeast) Gene
PTXBC000294
New product
Data sheet of TIMM17A-translocase of inner mitochondrial membrane 17 homolog A (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIMM17A-translocase of inner mitochondrial membrane 17 homolog A (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000294 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIMM17A |
| Origin species: | Human |
| Product name: | TIMM17A-translocase of inner mitochondrial membrane 17 homolog A (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC000294 |
| Gene id: | 10440 |
| Gene description: | translocase of inner mitochondrial membrane 17 homolog A (yeast) |
| Synonyms: | TIM17; TIM17A; mitochondrial import inner membrane translocase subunit Tim17-A; inner membrane preprotein translocase Tim17a; mitochondrial inner membrane translocase; translocase of inner mitochondrial membrane 17 homolog A (yeast) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggagtacgcgcgagagccttgcccatggcgaattgtggatgactgtggtggggcctttacgatgggtaccattggtggtggtatctttcaagcaatcaaaggttttcgcaattctccagtgggagtaaaccacagactacgagggagtttgacagctattaaaaccagggctccacagttaggaggtagctttgcagtttggggagggctgttttccatgattgactgtagtatggttcaagtcagaggaaaggaagatccctggaactccatcacaagtggtgccttaacgggagccatactggcagcaagaaatggaccagtggccatggttgggtcagccgcaatgggtggcattctcctagctttaattgaaggagctggtatcttgttgacaagatttgcctctgcacagtttcccaatggtcctcagtttgcagaagacccctcccagttgccttcaactcagttaccttcctcaccttttggagactatcgacaatatcagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - down-regulator of transcription 1, TBP-binding (negative cofactor 2) - transient receptor potential cation channel, subfamily V, member 2 - methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like - ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) |