MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene View larger

MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene

PTXBC017477

New product

Data sheet of MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC017477
Product type: DNA & cDNA
Ncbi symbol: MTHFD1L
Origin species: Human
Product name: MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene
Size: 2ug
Accessions: BC017477
Gene id: 25902
Gene description: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Synonyms: FTHFSDC1; MTC1THFS; dJ292B18.2; monofunctional C1-tetrahydrofolate synthase, mitochondrial; 10-formyl-THF synthetase; formyltetrahydrofolate synthetase domain containing 1; methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaatgagcatccagtggaaaacacgccagcttcaaagcaagcttcacgaggctgacattgtggtcctaggctcacctaagccagaagagattccccttacttggatacaaccaggaactactgttctcaactgctcccatgacttcctgtcagggaaggttgggtgtggctctccaagaatacattttggtggactcattgaggaagatgatgtgattctccttgctgcagctctgcgaattcagaacatggtcagtagtggaaggagatggcttcgtgaacagcagcacaggcggtggagacttcactgcttgaaacttcagcctctctcccctgtgccaagtgacattgagatttcaagaggacaaactccaaaagctgtggatgtccttgccaaggagattggattgcttgcagatgaaattgaaatctatggcaaaagcaaagccaaagtacgtttgtccgtgctagaaaggttaaaggatcaagcagatggaaaatacgtcttagttgctgggatcacacccacccctcttggagaagggaagagcacagtcaccatcgggcttgtgcaggctctgaccgcacacctgaatgtcaactcctttgcctgcttgaggcagccttcccaaggaccgacgtttggagtgaaaggaggagccgcgggtggtggatatgcccaggtcatccccatggaggagttcaaccttcacttgactggagacatccacgccatcaccgctgccaataacttgctggctgccgccatcgacacgaggattcttcatgaaaacacgcaaacagataaggctctgtataatcggctggttcctttagtgaatggtgtcagagaattttcagaaattcagcttgctcggctaaaaaaactgggaataaataagactgatccgagcacactgacagaagaggaagtgagtaaatttgcccgtctcgacatcgacccatctaccatcacgtggcagagagtattggatacaaatgaccgatttctacgaaaaataaccatcgggcagggaaacacagagaagggccattaccggcaggcgcagtttgacatcgcagtggccagcgagatcatggcggtgctggccctgacggacagcctcgcagacatgaaggcacggctgggaaggatggtggtggccagtgacaaaagcgggcagcctgtgacagcagatgatttgggggtgacaggtgctttgacagttttgatgaaagatgcaataaaaccaaacctgatgcagaccctggaagggacacctgtgttcgtgcatgcgggcccttttgctaacattgctcacggcaactcttcagtgttggctgataaaattgccctgaaactggttggtgaagaaggatttgtagtgaccgaagctggctttggtgctgacatcggaatggagaaattcttcaacatcaagtgccgagcttccggcttggtgcccaacgtggttgtgttagtggcaacggtgcgagctctgaagatgcatggaggcgggccaagtgtaacggctggtgttcctcttaagaaagaatatacagaggagaacatccagctggtggcagacggctgctgtaacctccagaagcaaattcagatcactcagctctttggggttcccgttgtggtggctctgaatgtcttcaagaccgacacccgcgctgagattgacttggtgtgtgagcttgcaaagcgggctggtgcctttgatgcagtcccctgctatcactggtcggttggtggaaaaggatcggtggacttggctcgggctgtgagagaggctgcgagtaaaagaagccgattccagttcctgtatgatgttcaggttccaattgtggacaagataaggaccattgctcaggctgtctatggagccaaagatattgaactctctcctgaggcacaagccaaaatagatcgttacactcaacagggttttggaaatttgcccatctgcatggcaaagacccacctttctctatctcaccaacctgacaaaaaaggtgtgccaagggacttcatcttacctatcagtgacgtccgggccagcataggcgctgggttcatttaccctttggtcggaacgatgagcaccatgccaggactgcccacccggccctgcttttatgacatagatcttgataccgaaacagaacaagttaaaggcttgttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
- eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
- serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7
- serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6

Buy MTHFD1L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene now

Add to cart