Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
EEF1D-eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene
PTXBC009907
New product
Data sheet of EEF1D-eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EEF1D-eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009907 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EEF1D |
| Origin species: | Human |
| Product name: | EEF1D-eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene |
| Size: | 2ug |
| Accessions: | BC009907 |
| Gene id: | 1936 |
| Gene description: | eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) |
| Synonyms: | EF-1D; EF1D; FP1047; elongation factor 1-delta; EF-1-delta; antigen NY-CO-4; eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein); eukaryotic translation elongation factor 1 delta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctacaaacttcctagcacatgagaagatctggttcgacaagttcaaatatgacgacgcagaaaggagattctacgagcagatgaacgggcctgtggcaggtgcctcccgccaggagaacggcgccagcgtgatcctccgtgacattgcgagagccagagagaacatccagaaatccctggctggaagctcaggccccggggcctccagcggcaccagcggagaccacggtgagctcgtcgtccggattgccagtctggaagtggagaaccagagtctgcgtggcgtggtacaggagctgcagcaggccatctccaagctggaggcccggctgaacgtgctggagaagagctcgcctggccaccgggccacggccccacagacccagcacgtatctcccatgcgccaagtggagcccccagccaagaagccagccacaccagcagaggatgacgaggatgatgacattgacctgtttggcagtgacaatgaggaggaggacaaggaggcggcacagctgcgggaggagcggctacggcagtacgcggagaagaaggccaagaagcctgcactggtggccaagtcctccatcctgctggatgtcaagccttgggatgatgagacggacatggctcagctggaggcctgtgtgcgctctatccagctggacgggctggtctggggggcttccaagctggtgcccgtgggctacggtatccggaagctacagattcagtgtgtggtggaggacgacaaggtggggacagacttgctggaggaggagatcaccaagtttgaggagcacgtgcagagtgtcgatatcgcagctttcaacaagatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7 - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6 - ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) - guanine nucleotide binding protein (G protein), beta polypeptide 3 |