Login to display prices
Login to display prices
UCHL3-ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) Gene View larger

UCHL3-ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) Gene

PTXBC018125

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UCHL3-ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UCHL3-ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018125
Product type: DNA & cDNA
Ncbi symbol: UCHL3
Origin species: Human
Product name: UCHL3-ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) Gene
Size: 2ug
Accessions: BC018125
Gene id: 7347
Gene description: ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
Synonyms: UCH-L3; ubiquitin carboxyl-terminal hydrolase isozyme L3; testicular tissue protein Li 221; ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase); ubiquitin thioesterase L3; ubiquitin thiolesterase; ubiquitin C-terminal hydrolase L3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagggtcaacgctggctgccgctggaggccaatcccgaggtcaccaaccagtttcttaaacaattaggtctacatcctaactggcaattcgttgatgtatatggaatggatcctgaactccttagcatggtaccaagaccagtctgtgcagtcttacttctctttcctattacagaaaagtatgaagtattcagaacagaagaggaagaaaaaataaaatctcagggacaagatgttacatcatcagtatatttcatgaagcaaacaatcagcaatgcctgtggaacaattggactgattcatgctattgcaaacaataaagacaagatgcactttgaatctggatcaaccttgaaaaaattcctggaggaatctgtgtcaatgagccctgaagaacgagccagatacctggagaactatgatgccatccgagttactcatgagaccagtgcccatgaaggtcagactgaggcaccaagtatagatgagaaagtagatcttcattttattgcattagttcatgtagatgggcatctctatgaattagatgggcggaagccatttccaattaaccatggtgaaactagtgatgaaactttattagaggatgccatagaagtttgcaagaagtttatggagcgcgaccctgatgaactaagatttaatgcgattgctctttctgcagcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - guanine nucleotide binding protein (G protein), beta polypeptide 3
- guanine nucleotide binding protein (G protein), beta polypeptide 2
- ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
- integrin-linked kinase-associated serine/threonine phosphatase 2C