Login to display prices
Login to display prices
GNB2-guanine nucleotide binding protein (G protein), beta polypeptide 2 Gene View larger

GNB2-guanine nucleotide binding protein (G protein), beta polypeptide 2 Gene

PTXBC010073

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNB2-guanine nucleotide binding protein (G protein), beta polypeptide 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNB2-guanine nucleotide binding protein (G protein), beta polypeptide 2 Gene

Proteogenix catalog: PTXBC010073
Ncbi symbol: GNB2
Product name: GNB2-guanine nucleotide binding protein (G protein), beta polypeptide 2 Gene
Size: 2ug
Accessions: BC010073
Gene id: 2783
Gene description: guanine nucleotide binding protein (G protein), beta polypeptide 2
Synonyms: guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2; G protein, beta-2 subunit; g protein subunit beta-2; guanine nucleotide binding protein (G protein), beta polypeptide 2; guanine nucleotide-binding protein G(I)/G(S)/G(T) beta subunit 2; signal-transducing guanine nucleotide-binding regulatory protein beta subunit; transducin beta chain 2; G protein subunit beta 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgagctggagcaactgagacaggaggccgagcagctccggaaccagatccgggatgcccgaaaagcatgtggggactcaacactgacccagatcacagctgggctggacccagtggggagaatccagatgaggacccggaggaccctccgtgggcacctggcaaagatctatgccatgcactgggggaccgactcaaggctgctggtcagcgcctcccaggatgggaagctcatcatctgggacagctacaccaccaacaaggtccacgccatcccgctgcgctcctcctgggtaatgacctgtgcctacgcgccctcagggaactttgtggcctgtggggggttggacaacatctgctccatctacagcctcaagacccgcgagggcaacgtcagggtcagccgggagctgcctggccacactgggtacctgtcgtgttgccgcttcctggatgacaaccaaatcatcaccagctctggggataccacctgtgccctgtgggacattgagacaggccagcagacagtgggttttgctggacacagtggggatgtgatgtccctgtccctggcccccgatggccgcacgtttgtgtcaggcgcctgtgatgcctctatcaagctgtgggacgtgcgggattccatgtgccgacagaccttcatcggccatgaatccgacatcaatgcagtggctttcttccccaacggctacgccttcaccaccggctctgacgacgccacgtgccgcctcttcgacctgcgggccgatcaggagctcctcatgtactcccatgacaacatcatctgtggcatcacctctgttgccttctcgcgcagcggacggctgctgctcgctggctacgacgacttcaactgcaacatctgggatgccatgaagggcgaccgtgcaggagtcctcgctggccacgacaaccgcgtgagctgcctcggggtcaccgacgatggcatggctgtggccacgggctcctgggactccttcctcaagatctggaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: