GNB2-guanine nucleotide binding protein (G protein), beta polypeptide 2 Gene View larger

GNB2-guanine nucleotide binding protein (G protein), beta polypeptide 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNB2-guanine nucleotide binding protein (G protein), beta polypeptide 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GNB2-guanine nucleotide binding protein (G protein), beta polypeptide 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010073
Product type: DNA & cDNA
Ncbi symbol: GNB2
Origin species: Human
Product name: GNB2-guanine nucleotide binding protein (G protein), beta polypeptide 2 Gene
Size: 2ug
Accessions: BC010073
Gene id: 2783
Gene description: guanine nucleotide binding protein (G protein), beta polypeptide 2
Synonyms: guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2; G protein, beta-2 subunit; g protein subunit beta-2; guanine nucleotide binding protein (G protein), beta polypeptide 2; guanine nucleotide-binding protein G(I)/G(S)/G(T) beta subunit 2; signal-transducing guanine nucleotide-binding regulatory protein beta subunit; transducin beta chain 2; G protein subunit beta 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgagctggagcaactgagacaggaggccgagcagctccggaaccagatccgggatgcccgaaaagcatgtggggactcaacactgacccagatcacagctgggctggacccagtggggagaatccagatgaggacccggaggaccctccgtgggcacctggcaaagatctatgccatgcactgggggaccgactcaaggctgctggtcagcgcctcccaggatgggaagctcatcatctgggacagctacaccaccaacaaggtccacgccatcccgctgcgctcctcctgggtaatgacctgtgcctacgcgccctcagggaactttgtggcctgtggggggttggacaacatctgctccatctacagcctcaagacccgcgagggcaacgtcagggtcagccgggagctgcctggccacactgggtacctgtcgtgttgccgcttcctggatgacaaccaaatcatcaccagctctggggataccacctgtgccctgtgggacattgagacaggccagcagacagtgggttttgctggacacagtggggatgtgatgtccctgtccctggcccccgatggccgcacgtttgtgtcaggcgcctgtgatgcctctatcaagctgtgggacgtgcgggattccatgtgccgacagaccttcatcggccatgaatccgacatcaatgcagtggctttcttccccaacggctacgccttcaccaccggctctgacgacgccacgtgccgcctcttcgacctgcgggccgatcaggagctcctcatgtactcccatgacaacatcatctgtggcatcacctctgttgccttctcgcgcagcggacggctgctgctcgctggctacgacgacttcaactgcaacatctgggatgccatgaagggcgaccgtgcaggagtcctcgctggccacgacaaccgcgtgagctgcctcggggtcaccgacgatggcatggctgtggccacgggctcctgggactccttcctcaagatctggaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
- integrin-linked kinase-associated serine/threonine phosphatase 2C
- solute carrier family 40 (iron-regulated transporter), member 1
- transforming growth factor, beta receptor associated protein 1

Buy GNB2-guanine nucleotide binding protein (G protein), beta polypeptide 2 Gene now

Add to cart