Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ACTR1A-ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) Gene
PTXBC000693
New product
Data sheet of ACTR1A-ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ACTR1A-ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000693 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ACTR1A |
| Origin species: | Human |
| Product name: | ACTR1A-ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC000693 |
| Gene id: | 10121 |
| Gene description: | ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) |
| Synonyms: | ARP1; Arp1A; CTRN1; alpha-centractin; actin-RPV; centractin; centrosome-associated actin homolog; ARP1 actin-related protein 1 homolog A, centractin alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagtcctacgatgtgatcgccaaccagcctgtcgtgatcgacaacggatccggtgtgattaaagctggttttgctggtgatcagatccccaaatactgctttccaaactatgtgggccgacccaagcacgttcgtgtcatggcaggagcccttgaaggcgacatcttcattggccccaaagctgaggagcaccgagggctgctttcaatccgctatcccatggagcatggcatcgtcaaggattggaacgacatggaacgcatttggcaatatgtctattctaaggaccagctgcagactttctcagaggagcatcctgtgctcctgactgaggcgcctttaaacccacgaaaaaaccgggaacgagctgccgaagttttcttcgagaccttcaatgtgcccgctcttttcatctccatgcaagctgtactcagcctttacgctacaggcaggaccacaggggtggtgctggattctggggatggagtcacccatgctgtgcccatctatgagggctttgccatgccccactccatcatgcgcatcgacatcgcgggccgggacgtctctcgcttcctgcgcctctacctgcgtaaggagggctacgacttccactcatcctctgagtttgagattgtcaaggccataaaagaaagagcctgttacctatccataaacccccaaaaggatgagacgctagagacagagaaagctcagtactacctgcctgatggcagcaccattgagattggtccttcccgattccgggcccctgagttgctcttcaggccagatttgattggagaggagagtgaaggcatccacgaggtcctggtgttcgccattcagaagtcagacatggacctgcggcgcacgcttttctctaacattgtcctctcaggaggctctaccctgttcaaaggttttggtgacaggctcctgagtgaagtgaagaaactagctccaaaagatgtgaagatcaggatatctgcacctcaggagagactgtattccacgtggattgggggctccatccttgcctccctggacacctttaagaagatgtgggtctccaaaaaggaatatgaggaagacggtgcccgatccatccacagaaaaaccttctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - integrin-linked kinase-associated serine/threonine phosphatase 2C - solute carrier family 40 (iron-regulated transporter), member 1 - transforming growth factor, beta receptor associated protein 1 - ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa |