ILKAP-integrin-linked kinase-associated serine/threonine phosphatase 2C Gene View larger

ILKAP-integrin-linked kinase-associated serine/threonine phosphatase 2C Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ILKAP-integrin-linked kinase-associated serine/threonine phosphatase 2C Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ILKAP-integrin-linked kinase-associated serine/threonine phosphatase 2C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006576
Product type: DNA & cDNA
Ncbi symbol: ILKAP
Origin species: Human
Product name: ILKAP-integrin-linked kinase-associated serine/threonine phosphatase 2C Gene
Size: 2ug
Accessions: BC006576
Gene id: 80895
Gene description: integrin-linked kinase-associated serine/threonine phosphatase 2C
Synonyms: ILKAP2; ILKAP3; PP2C-DELTA; PPM1O; integrin-linked kinase-associated serine/threonine phosphatase 2C; integrin-linked kinase associated phosphatase; protein phosphatase 2c, delta isozyme; protein phosphatase, Mg2+/Mn2+ dependent 1O; ILK associated serine/threonine phosphatase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacctcttcggggacctgccggagcccgagcgctcgccgcgcccggctgccgggaaagaagctcagaaaggacccctgctctttgatgacctccctccggccagcagtactgactcaggatcagggggacctttgctttttgatgatctcccacccgctagcagtggcgattcaggttctcttgccacatcaatatcccagatggtaaagactgaagggaaaggagcaaagagaaaaacctccgaggaagagaagaatggcagtgaagagcttgtggaaaagaaagtttgtaaagcctcttcggtgatctttggtctgaagggctatgtggctgagcggaagggtgagagggaggagatgcaggatgcccacgtcatcctgaacgacatcaccgaggagtgtaggcccccatcgtccctcattactcgggtttcatattttgctgtttttgatggacatggaggaattcgagcctcaaaatttgctgcacagaatttgcatcaaaacttaatcagaaaatttcctaaaggagatgtaatcagtgtagagaaaaccgtgaagagatgccttttggacactttcaagcatactgatgaagagttccttaaacaagcttccagccagaagcctgcctggaaagatgggtccactgccacgtgtgttctggctgtagacaacattctttatattgccaacctcggagatagtcgggcaatcttgtgtcgttataatgaggagagtcaaaaacatgcagccttaagcctcagcaaagagcataatccaactcagtatgaagagcggatgaggatacagaaggctggaggaaacgtcagggatgggcgtgttttgggcgtgctagaggtgtcacgctccattggggacgggcagtacaagcgctgcggtgtcacctctgtgcccgacatcagacgctgccagctgacccccaatgacaggttcattttgttggcctgtgatgggctcttcaaggtctttaccccagaagaagccgtgaacttcatcttgtcctgtctcgaggatgaaaagatccagacccgggaagggaagtccgcagccgacgcccgctacgaagcagcctgcaacaggctggccaacaaggcggtgcagcggggctcggccgacaacgtcactgtgatggtggtgcggatagggcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 40 (iron-regulated transporter), member 1
- transforming growth factor, beta receptor associated protein 1
- ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa
- epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)

Buy ILKAP-integrin-linked kinase-associated serine/threonine phosphatase 2C Gene now

Add to cart