Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ILKAP-integrin-linked kinase-associated serine/threonine phosphatase 2C Gene
PTXBC006576
New product
Data sheet of ILKAP-integrin-linked kinase-associated serine/threonine phosphatase 2C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ILKAP-integrin-linked kinase-associated serine/threonine phosphatase 2C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006576 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ILKAP |
| Origin species: | Human |
| Product name: | ILKAP-integrin-linked kinase-associated serine/threonine phosphatase 2C Gene |
| Size: | 2ug |
| Accessions: | BC006576 |
| Gene id: | 80895 |
| Gene description: | integrin-linked kinase-associated serine/threonine phosphatase 2C |
| Synonyms: | ILKAP2; ILKAP3; PP2C-DELTA; PPM1O; integrin-linked kinase-associated serine/threonine phosphatase 2C; integrin-linked kinase associated phosphatase; protein phosphatase 2c, delta isozyme; protein phosphatase, Mg2+/Mn2+ dependent 1O; ILK associated serine/threonine phosphatase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacctcttcggggacctgccggagcccgagcgctcgccgcgcccggctgccgggaaagaagctcagaaaggacccctgctctttgatgacctccctccggccagcagtactgactcaggatcagggggacctttgctttttgatgatctcccacccgctagcagtggcgattcaggttctcttgccacatcaatatcccagatggtaaagactgaagggaaaggagcaaagagaaaaacctccgaggaagagaagaatggcagtgaagagcttgtggaaaagaaagtttgtaaagcctcttcggtgatctttggtctgaagggctatgtggctgagcggaagggtgagagggaggagatgcaggatgcccacgtcatcctgaacgacatcaccgaggagtgtaggcccccatcgtccctcattactcgggtttcatattttgctgtttttgatggacatggaggaattcgagcctcaaaatttgctgcacagaatttgcatcaaaacttaatcagaaaatttcctaaaggagatgtaatcagtgtagagaaaaccgtgaagagatgccttttggacactttcaagcatactgatgaagagttccttaaacaagcttccagccagaagcctgcctggaaagatgggtccactgccacgtgtgttctggctgtagacaacattctttatattgccaacctcggagatagtcgggcaatcttgtgtcgttataatgaggagagtcaaaaacatgcagccttaagcctcagcaaagagcataatccaactcagtatgaagagcggatgaggatacagaaggctggaggaaacgtcagggatgggcgtgttttgggcgtgctagaggtgtcacgctccattggggacgggcagtacaagcgctgcggtgtcacctctgtgcccgacatcagacgctgccagctgacccccaatgacaggttcattttgttggcctgtgatgggctcttcaaggtctttaccccagaagaagccgtgaacttcatcttgtcctgtctcgaggatgaaaagatccagacccgggaagggaagtccgcagccgacgcccgctacgaagcagcctgcaacaggctggccaacaaggcggtgcagcggggctcggccgacaacgtcactgtgatggtggtgcggatagggcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 40 (iron-regulated transporter), member 1 - transforming growth factor, beta receptor associated protein 1 - ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa - epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) |