Login to display prices
Login to display prices
UQCRQ-ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa Gene View larger

UQCRQ-ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa Gene

PTXBC001390

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UQCRQ-ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UQCRQ-ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa Gene

Proteogenix catalog: PTXBC001390
Ncbi symbol: UQCRQ
Product name: UQCRQ-ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa Gene
Size: 2ug
Accessions: BC001390
Gene id: 27089
Gene description: ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa
Synonyms: MC3DN4; QCR8; QP-C; QPC; UQCR7; cytochrome b-c1 complex subunit 8; complex III subunit 8; complex III subunit VIII; low molecular mass ubiquinone-binding protein (9.5kD); ubiquinol-cytochrome c reductase complex 9.5 kDa protein; ubiquinol-cytochrome c reductase complex ubiquinone-binding protein QP-C; ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa; ubiquinol-cytochrome c reductase complex III subunit VII
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccgcgagtttgggaatctgacgcggatgcggcatgtgatcagctacagcttgtcaccgttcgagcagcgcgcctatccgcacgtcttcactaaaggaatccccaatgttctgcgccgcattcgggagtctttctttcgcgtggtgccgcagtttgtagtgttttatcttatctacacatgggggactgaagagttcgagagatccaagaggaagaatccagctgcctatgaaaatgacaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: