Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UQCRQ-ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa Gene
PTXBC001390
New product
Data sheet of UQCRQ-ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UQCRQ-ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001390 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UQCRQ |
| Origin species: | Human |
| Product name: | UQCRQ-ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa Gene |
| Size: | 2ug |
| Accessions: | BC001390 |
| Gene id: | 27089 |
| Gene description: | ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa |
| Synonyms: | MC3DN4; QCR8; QP-C; QPC; UQCR7; cytochrome b-c1 complex subunit 8; complex III subunit 8; complex III subunit VIII; low molecular mass ubiquinone-binding protein (9.5kD); ubiquinol-cytochrome c reductase complex 9.5 kDa protein; ubiquinol-cytochrome c reductase complex ubiquinone-binding protein QP-C; ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa; ubiquinol-cytochrome c reductase complex III subunit VII |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggccgcgagtttgggaatctgacgcggatgcggcatgtgatcagctacagcttgtcaccgttcgagcagcgcgcctatccgcacgtcttcactaaaggaatccccaatgttctgcgccgcattcgggagtctttctttcgcgtggtgccgcagtttgtagtgttttatcttatctacacatgggggactgaagagttcgagagatccaagaggaagaatccagctgcctatgaaaatgacaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) - IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) - mitogen-activated protein kinase 1 interacting protein 1-like - BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) |