Login to display prices
Login to display prices
MAPK1IP1L-mitogen-activated protein kinase 1 interacting protein 1-like Gene View larger

MAPK1IP1L-mitogen-activated protein kinase 1 interacting protein 1-like Gene

PTXBC015621

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAPK1IP1L-mitogen-activated protein kinase 1 interacting protein 1-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAPK1IP1L-mitogen-activated protein kinase 1 interacting protein 1-like Gene

Proteogenix catalog: PTXBC015621
Ncbi symbol: MAPK1IP1L
Product name: MAPK1IP1L-mitogen-activated protein kinase 1 interacting protein 1-like Gene
Size: 2ug
Accessions: BC015621
Gene id: 93487
Gene description: mitogen-activated protein kinase 1 interacting protein 1-like
Synonyms: C14orf32; MISS; c14_5346; MAPK-interacting and spindle-stabilizing protein-like; MAPK-interacting and spindle-stabilizing protein; mitogen-activated protein kinase 1 interacting protein 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgatgaattttcgttggcagatgcactacctgaacactcccctgccaaaacctctgctgtgagcaatacaaaacctggccaacctcctcaaggctggccaggctccaacccttggaataatccgagtgctccatcttcagtgccatctggactcccaccaagtgcaacaccctccactgtgccttttggaccagcaccaacaggaatgtatccctccgtgcctcccaccggaccacctccaggacccccagcaccctttcctccttccggaccatcatgtcccccacctggtggtccttatccagccccaactgtgccgggccctggccccacagggccatatcctacaccaaatatgccctttccagagctacccagaccatatggtgcacccacagatccagctgcagctggtcctttaggtccatggggatccatgtcttctggaccttgggcgccaggaatgggagggcagtatcctacccctaatatgccatatccatctccaggcccatatcccgctcctcctcctccccaggcccctggggcagcaccacctgttccatggggcaccgttccaccaggagcctggggaccaccagcaccatatcctgcccctacaggatcgtatcccacaccaggactctatcctactcccagtaatcctttccaagtgccttcaggaccttctggtgctccaccaatgcctggtggcccccattcttaccattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: