Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MAPK1IP1L-mitogen-activated protein kinase 1 interacting protein 1-like Gene
PTXBC015621
New product
Data sheet of MAPK1IP1L-mitogen-activated protein kinase 1 interacting protein 1-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAPK1IP1L-mitogen-activated protein kinase 1 interacting protein 1-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015621 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAPK1IP1L |
| Origin species: | Human |
| Product name: | MAPK1IP1L-mitogen-activated protein kinase 1 interacting protein 1-like Gene |
| Size: | 2ug |
| Accessions: | BC015621 |
| Gene id: | 93487 |
| Gene description: | mitogen-activated protein kinase 1 interacting protein 1-like |
| Synonyms: | C14orf32; MISS; c14_5346; MAPK-interacting and spindle-stabilizing protein-like; MAPK-interacting and spindle-stabilizing protein; mitogen-activated protein kinase 1 interacting protein 1 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgatgaattttcgttggcagatgcactacctgaacactcccctgccaaaacctctgctgtgagcaatacaaaacctggccaacctcctcaaggctggccaggctccaacccttggaataatccgagtgctccatcttcagtgccatctggactcccaccaagtgcaacaccctccactgtgccttttggaccagcaccaacaggaatgtatccctccgtgcctcccaccggaccacctccaggacccccagcaccctttcctccttccggaccatcatgtcccccacctggtggtccttatccagccccaactgtgccgggccctggccccacagggccatatcctacaccaaatatgccctttccagagctacccagaccatatggtgcacccacagatccagctgcagctggtcctttaggtccatggggatccatgtcttctggaccttgggcgccaggaatgggagggcagtatcctacccctaatatgccatatccatctccaggcccatatcccgctcctcctcctccccaggcccctggggcagcaccacctgttccatggggcaccgttccaccaggagcctggggaccaccagcaccatatcctgcccctacaggatcgtatcccacaccaggactctatcctactcccagtaatcctttccaagtgccttcaggaccttctggtgctccaccaatgcctggtggcccccattcttaccattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) - Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) - PAX interacting (with transcription-activation domain) protein 1 - glycine amidinotransferase (L-arginine:glycine amidinotransferase) |