MAPK1IP1L-mitogen-activated protein kinase 1 interacting protein 1-like Gene View larger

MAPK1IP1L-mitogen-activated protein kinase 1 interacting protein 1-like Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAPK1IP1L-mitogen-activated protein kinase 1 interacting protein 1-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAPK1IP1L-mitogen-activated protein kinase 1 interacting protein 1-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015621
Product type: DNA & cDNA
Ncbi symbol: MAPK1IP1L
Origin species: Human
Product name: MAPK1IP1L-mitogen-activated protein kinase 1 interacting protein 1-like Gene
Size: 2ug
Accessions: BC015621
Gene id: 93487
Gene description: mitogen-activated protein kinase 1 interacting protein 1-like
Synonyms: C14orf32; MISS; c14_5346; MAPK-interacting and spindle-stabilizing protein-like; MAPK-interacting and spindle-stabilizing protein; mitogen-activated protein kinase 1 interacting protein 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgatgaattttcgttggcagatgcactacctgaacactcccctgccaaaacctctgctgtgagcaatacaaaacctggccaacctcctcaaggctggccaggctccaacccttggaataatccgagtgctccatcttcagtgccatctggactcccaccaagtgcaacaccctccactgtgccttttggaccagcaccaacaggaatgtatccctccgtgcctcccaccggaccacctccaggacccccagcaccctttcctccttccggaccatcatgtcccccacctggtggtccttatccagccccaactgtgccgggccctggccccacagggccatatcctacaccaaatatgccctttccagagctacccagaccatatggtgcacccacagatccagctgcagctggtcctttaggtccatggggatccatgtcttctggaccttgggcgccaggaatgggagggcagtatcctacccctaatatgccatatccatctccaggcccatatcccgctcctcctcctccccaggcccctggggcagcaccacctgttccatggggcaccgttccaccaggagcctggggaccaccagcaccatatcctgcccctacaggatcgtatcccacaccaggactctatcctactcccagtaatcctttccaagtgccttcaggaccttctggtgctccaccaatgcctggtggcccccattcttaccattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - BMP and activin membrane-bound inhibitor homolog (Xenopus laevis)
- Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
- PAX interacting (with transcription-activation domain) protein 1
- glycine amidinotransferase (L-arginine:glycine amidinotransferase)

Buy MAPK1IP1L-mitogen-activated protein kinase 1 interacting protein 1-like Gene now

Add to cart