PTXBC019252
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC019252 |
Product type: | DNA & cDNA |
Ncbi symbol: | BAMBI |
Origin species: | Human |
Product name: | BAMBI-BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) Gene |
Size: | 2ug |
Accessions: | BC019252 |
Gene id: | 25805 |
Gene description: | BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) |
Synonyms: | NMA; BMP and activin membrane-bound inhibitor homolog; non-metastatic gene A protein; BMP and activin membrane bound inhibitor |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggatcgccactccagctacatcttcatctggctgcagctggagctctgcgccatggccgtgctgctcaccaaaggtgaaattcgatgctactgtgatgctgcccactgtgtagccactggttatatgtgtaaatctgagctcagcgcctgcttctctagacttcttgatcctcagaactcaaattccccactcacccatggctgcctggactctcttgcaagcacgacagacatctgccaagccaaacaggcccgaaaccactctggcaccaccatacccacattggaatgctgtcatgaagacatgtgcaattacagagggctgcacgatgttctctctcctcccaggggtgaggcctcaggacaaggaaacaggtatcagcatgatggtagcagaaaccttatcaccaaggtgcaggagctgacttcttccaaagagttgtggttccgggcagcggtcattgccgtgcccattgctggagggctgattttagtgttgcttattatgttggccctgaggatgcttcgaagtgaaaataagaggctgcaggatcagcggcaacagatgctctcccgtttgcactacagctttcacggacaccattccaaaaaggggcaggttgcaaagttagacttggaatgcatggtgccggtcagtgggcacgagaactgctgtctgacctgtgataaaatgagacaagcagacctcagcaacgataagatcctctcgcttgttcactggggcatgtacagtgggcacgggaagctggaattcgtatga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) - PAX interacting (with transcription-activation domain) protein 1 - glycine amidinotransferase (L-arginine:glycine amidinotransferase) - neural precursor cell expressed, developmentally down-regulated 1 |