Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
BAMBI-BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) Gene
PTXBC019252
New product
Data sheet of BAMBI-BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BAMBI-BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC019252 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BAMBI |
| Origin species: | Human |
| Product name: | BAMBI-BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) Gene |
| Size: | 2ug |
| Accessions: | BC019252 |
| Gene id: | 25805 |
| Gene description: | BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) |
| Synonyms: | NMA; BMP and activin membrane-bound inhibitor homolog; non-metastatic gene A protein; BMP and activin membrane bound inhibitor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatcgccactccagctacatcttcatctggctgcagctggagctctgcgccatggccgtgctgctcaccaaaggtgaaattcgatgctactgtgatgctgcccactgtgtagccactggttatatgtgtaaatctgagctcagcgcctgcttctctagacttcttgatcctcagaactcaaattccccactcacccatggctgcctggactctcttgcaagcacgacagacatctgccaagccaaacaggcccgaaaccactctggcaccaccatacccacattggaatgctgtcatgaagacatgtgcaattacagagggctgcacgatgttctctctcctcccaggggtgaggcctcaggacaaggaaacaggtatcagcatgatggtagcagaaaccttatcaccaaggtgcaggagctgacttcttccaaagagttgtggttccgggcagcggtcattgccgtgcccattgctggagggctgattttagtgttgcttattatgttggccctgaggatgcttcgaagtgaaaataagaggctgcaggatcagcggcaacagatgctctcccgtttgcactacagctttcacggacaccattccaaaaaggggcaggttgcaaagttagacttggaatgcatggtgccggtcagtgggcacgagaactgctgtctgacctgtgataaaatgagacaagcagacctcagcaacgataagatcctctcgcttgttcactggggcatgtacagtgggcacgggaagctggaattcgtatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) - PAX interacting (with transcription-activation domain) protein 1 - glycine amidinotransferase (L-arginine:glycine amidinotransferase) - neural precursor cell expressed, developmentally down-regulated 1 |