BAMBI-BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) Gene View larger

BAMBI-BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BAMBI-BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BAMBI-BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019252
Product type: DNA & cDNA
Ncbi symbol: BAMBI
Origin species: Human
Product name: BAMBI-BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) Gene
Size: 2ug
Accessions: BC019252
Gene id: 25805
Gene description: BMP and activin membrane-bound inhibitor homolog (Xenopus laevis)
Synonyms: NMA; BMP and activin membrane-bound inhibitor homolog; non-metastatic gene A protein; BMP and activin membrane bound inhibitor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcgccactccagctacatcttcatctggctgcagctggagctctgcgccatggccgtgctgctcaccaaaggtgaaattcgatgctactgtgatgctgcccactgtgtagccactggttatatgtgtaaatctgagctcagcgcctgcttctctagacttcttgatcctcagaactcaaattccccactcacccatggctgcctggactctcttgcaagcacgacagacatctgccaagccaaacaggcccgaaaccactctggcaccaccatacccacattggaatgctgtcatgaagacatgtgcaattacagagggctgcacgatgttctctctcctcccaggggtgaggcctcaggacaaggaaacaggtatcagcatgatggtagcagaaaccttatcaccaaggtgcaggagctgacttcttccaaagagttgtggttccgggcagcggtcattgccgtgcccattgctggagggctgattttagtgttgcttattatgttggccctgaggatgcttcgaagtgaaaataagaggctgcaggatcagcggcaacagatgctctcccgtttgcactacagctttcacggacaccattccaaaaaggggcaggttgcaaagttagacttggaatgcatggtgccggtcagtgggcacgagaactgctgtctgacctgtgataaaatgagacaagcagacctcagcaacgataagatcctctcgcttgttcactggggcatgtacagtgggcacgggaagctggaattcgtatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
- PAX interacting (with transcription-activation domain) protein 1
- glycine amidinotransferase (L-arginine:glycine amidinotransferase)
- neural precursor cell expressed, developmentally down-regulated 1

Buy BAMBI-BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) Gene now

Add to cart