GATM-glycine amidinotransferase (L-arginine:glycine amidinotransferase) Gene View larger

GATM-glycine amidinotransferase (L-arginine:glycine amidinotransferase) Gene

PTXBC004141

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GATM-glycine amidinotransferase (L-arginine:glycine amidinotransferase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GATM-glycine amidinotransferase (L-arginine:glycine amidinotransferase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004141
Product type: DNA & cDNA
Ncbi symbol: GATM
Origin species: Human
Product name: GATM-glycine amidinotransferase (L-arginine:glycine amidinotransferase) Gene
Size: 2ug
Accessions: BC004141
Gene id: 2628
Gene description: glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Synonyms: AGAT; CCDS3; glycine amidinotransferase, mitochondrial; glycine amidinotransferase (L-arginine:glycine amidinotransferase); testicular secretory protein Li 19; transamidinase; glycine amidinotransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgcgggtgcggtgtctgcgcggcgggagccgcggcgccgaggcggtgcactacatcggatctcggcttggacgaaccttgacaggatgggtgcagcgaactttccagagcacccaggcagctacggcttcctcccggaactcctgtgcagctgacgacaaagccactgagcctctgcccaaggactgccctgtctcttcttacaacgaatgggaccccttagaggaagtgatagtgggcagagcagaaaacgcctgtgttccaccgttcaccatcgaggtgaaggccaacacatatgaaaagtactggccattttaccagaagcaaggagggcattattttcccaaagatcatttgaaaaaggctgttgctgaaattgaagaaatgtgcaatattttaaaaacggaaggagtgacagtaaggaggcctgaccccattgactggtcattgaagtataaaactcctgattttgagtctacgggtttatacagtgcaatgcctcgagacatcctgatagttgtgggcaatgagattatcgaggctcccatggcatggcgttcacgcttctttgagtaccgagcgtacaggtcaattatcaaagactacttccaccgtggcgccaagtggacaacagctcctaagcccacaatggctgatgagctttataaccaggattatcccatccactctgtagaagacagacacaaattggctgctcagggaaaatttgtgacaactgagtttgagccatgctttgatgctgctgacttcattcgagctggaagagatatttttgcacagagaagccaggttacaaactacctaggcattgaatggatgcgtaggcatcttgctccagactacagagtgcatatcatctcctttaaagatcccaatcccatgcatattgatgctaccttcaacatcattggacctggtattgtgctttccaaccctgaccgaccatgtcaccagattgatcttttcaagaaagcaggatggactatcattactcctccaacaccaatcatcccagacgatcatccactctggatgtcatccaaatggctttccatgaatgtcttaatgctagatgaaaaacgtgttatggtggatgccaatgaagttccaattcaaaagatgtttgaaaagctgggtatcactaccattaaagttaacattcgtaatgccaattccctgggaggaggcttccattgctggacctgcgatgtccggcgccgaggcaccttacagtcctacttggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - neural precursor cell expressed, developmentally down-regulated 1
- PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
- ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
- v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)

Buy GATM-glycine amidinotransferase (L-arginine:glycine amidinotransferase) Gene now

Add to cart