Login to display prices
Login to display prices
ERBB3-v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) Gene View larger

ERBB3-v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) Gene

PTXBC002706

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ERBB3-v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ERBB3-v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) Gene

Proteogenix catalog: PTXBC002706
Ncbi symbol: ERBB3
Product name: ERBB3-v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) Gene
Size: 2ug
Accessions: BC002706
Gene id: 2065
Gene description: v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)
Synonyms: p180-ErbB3; erbB3-S; c-erbB3; ErbB-3; HER3; LCCS2; MDA-BF-1; c-erbB-3; p45-sErbB3; p85-sErbB3; receptor tyrosine-protein kinase erbB-3; human epidermal growth factor receptor 3; proto-oncogene-like protein c-ErbB-3; tyrosine kinase-type cell surface receptor HER3; v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3; erb-b2 receptor tyrosine kinase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagggcgaacgacgctctgcaggtgctgggcttgcttttcagcctggcccggggctccgaggtgggcaactctcaggcagtgtgtcctgggactctgaatggcctgagtgtgaccggcgatgctgagaaccaataccagacactgtacaagctctacgagaggtgtgaggtggtgatggggaaccttgagattgtgctcacgggacacaatgccgacctctccttcctgcagtggattcgagaagtgacaggctatgtcctcgtggccatgaatgaattctctactctaccattgcccaacctccgcgtggtgcgagggacccaggtctacgatgggaagtttgccatcttcgtcatgttgaactataacaccaactccagccacgctctgcgccagctccgcttgactcagctcaccgagattctgtcagggggtgtttatattgagaagaacgataagctttgtcacatggacacaattgactggagggacatcgtgagggaccgagatgctgagatagtggtgaaggacaatggcagaagctgtcccccctgtcatgaggtttgcaaggggcgatgctggggtcctggatcagaagactgccagacattgaccaagaccatctgtgctcctcagtgtaatggtcactgctttgggcccaaccccaaccagtgctgccatgatgagtgtgccgggggctgctcaggccctcaggacacagactgctttgcctgccggcacttcaatgacagtggagcctgtgtacctcgctgtccacagcctcttgtctacaacaagctaactttccagctggaacccaatccccacaccaagtatcagtatggaggagtttgtgtagccagctgtccccataactttgtggtggatcaaacatcctgtgtcagggcctgtcctcctgacaagatggaagtagataaaaatgggctcaagatgtgtgagccttgtgggggactatgtcccaaagccttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: