Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GNB2-guanine nucleotide binding protein (G protein), beta polypeptide 2 Gene
PTXBC012348
New product
Data sheet of GNB2-guanine nucleotide binding protein (G protein), beta polypeptide 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNB2-guanine nucleotide binding protein (G protein), beta polypeptide 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012348 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNB2 |
| Origin species: | Human |
| Product name: | GNB2-guanine nucleotide binding protein (G protein), beta polypeptide 2 Gene |
| Size: | 2ug |
| Accessions: | BC012348 |
| Gene id: | 2783 |
| Gene description: | guanine nucleotide binding protein (G protein), beta polypeptide 2 |
| Synonyms: | guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2; G protein, beta-2 subunit; g protein subunit beta-2; guanine nucleotide binding protein (G protein), beta polypeptide 2; guanine nucleotide-binding protein G(I)/G(S)/G(T) beta subunit 2; signal-transducing guanine nucleotide-binding regulatory protein beta subunit; transducin beta chain 2; G protein subunit beta 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtgagctggagcaactgagacaggaggccgagcagctccggaaccagatccgggatgcccgaaaagcatgtggggactcaacactgacccagatcacagctgggctggacccagtggggagaatccagatgaggacccggaggaccctccgtgggcacctggcaaagatctatgccatgcactgggggaccgactcaaggctgctggtcagcgcctcccaggatgggaagctcatcatctgggacagctacaccaccaacaaggtccacgccatcccgctgcgctcctcctgggtaatgacctgtgcctacgcgccctcagggaactttgtggcctgtggggggttggacaacatctgctccatctacagcctcaagacccgcgagggcaacgtcagggtcagccgggagctgcctggccacactgggtacctgtcgtgttgccgcttcctggatgacaaccaaatcatcaccagctctggggataccacctgtgccctgtgggacattgagacaggccagcagacagtgggttttgctggacacagtggggatgtgatgtccctgtccctggcccccgatggccgcacgtttgtgtcaggcgcctgtgatgcctctatcaagctgtgggacgtgcgggattccatgtgccgacagaccttcatcggccatgaatccgacatcaatgcagtggctttcttccccaacggctacgccttcaccaccggctctgacgacgccacgtgccgcctcttcgacctgcgggccgatcaggagctcctcatgtactcccatgacaacatcatctgtggcatcacctctgttgccttctcgcgcagcggacggctgctgctcgctggctacgacgacttcaactgcaacatctgggatgccatgaagggcgaccgtgcaggagtcctcgctggccacgacaaccgcgtgagctgccttggggtcaccgacgatggcatggctgtggccacgggctcctgggactccttcctcaagatctggaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), beta polypeptide 4 - guanine nucleotide binding protein (G protein), beta polypeptide 1 - c-fos induced growth factor (vascular endothelial growth factor D) - ganglioside-induced differentiation-associated protein 1-like 1 |