GDAP1L1-ganglioside-induced differentiation-associated protein 1-like 1 Gene View larger

GDAP1L1-ganglioside-induced differentiation-associated protein 1-like 1 Gene

PTXBC000199

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GDAP1L1-ganglioside-induced differentiation-associated protein 1-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GDAP1L1-ganglioside-induced differentiation-associated protein 1-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000199
Product type: DNA & cDNA
Ncbi symbol: GDAP1L1
Origin species: Human
Product name: GDAP1L1-ganglioside-induced differentiation-associated protein 1-like 1 Gene
Size: 2ug
Accessions: BC000199
Gene id: 78997
Gene description: ganglioside-induced differentiation-associated protein 1-like 1
Synonyms: dJ881L22.1; dJ995J12.1.1; ganglioside-induced differentiation-associated protein 1-like 1; GDAP1-L1; ganglioside induced differentiation associated protein 1 like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgacccccaacaatctgacccccaccaactgcagctggtggcccatctccgcgctggagagcgatgcggccaagccagcggaggcccccgacgctcccgaggcggccagccccgcccattggcccagggagagcctggttctgtaccactggacccagtccttcagctcgcagaaggtgcggctggtgatcgccgagaagggcctggtgtgcgaggagcgggacgtgagcctgccacagagcgagcacaaggagccctggttcatgcggctcaacctgggcgaggaggtgcccgtcatcatccaccgcgacaacatcatcagtgactatgaccagatcattgactatgtggagcgcaccttcacaggagagcacgtggtggccctgatgcccgaggtgggcagcctgcagcacgcacgggtgctgcagtaccgggagctgctggacgcactgcccatggatgcctacacgcatggctgcatcctgcatcccgagctcaccaccgactccatgatccccaagtacgccacggccgagatccgcagacatttagccaatgccaccacggacctcatgaaactggaccatgaagaggagccccagctctccgagccctacctttctaaacaaaagaagctcatggccaagatcttggagcatgatgatgtgagctacctgaagaagatcctcggggaactggccatggtgctggaccagattgaggcggagctggagaagaggaagctggagaacgaggggcagaaatgcgagctgtggctctgtggctgtgccttcaccctcgctgatgtcctcctgggagccaccctgcaccgcctcaagttcctgggactgtccaagaaatactgggaagatggcagccggcccaacctgcagtccttctttgagagggtccagagacgctttgccttccggaaagtcctgggtgacatccacaccaccctgctgtcggccgtcatccccaatgctttccggctggtcaagaggaaacccccatccttcttcggggcgtccttcctcatgggctccctgggtgggatgggctactttgcctactggtacctcaagaaaaaatacatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
- NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)
- disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)
- phospholysine phosphohistidine inorganic pyrophosphate phosphatase

Buy GDAP1L1-ganglioside-induced differentiation-associated protein 1-like 1 Gene now

Add to cart