Login to display prices
Login to display prices
CDS2-CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 Gene View larger

CDS2-CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 Gene

PTXBC025751

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDS2-CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CDS2-CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 Gene

Proteogenix catalog: PTXBC025751
Ncbi symbol: CDS2
Product name: CDS2-CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 Gene
Size: 2ug
Accessions: BC025751
Gene id: 8760
Gene description: CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Synonyms: phosphatidate cytidylyltransferase 2; CDP-DAG synthase 2; CDP-DG synthase 2; CDP-DG synthetase 2; CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2; CDP-diglyceride diphosphorylase 2; CDP-diglyceride pyrophosphorylase 2; CDP-diglyceride synthase 2; CDP-diglyceride synthetase 2; CDS 2; CTP:phosphatidate cytidylyltransferase 2; CDP-diacylglycerol synthase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagagctgaggcagagggtggcccatgagccggttgcgccacccgaggacaaggagtcagagtcagaagcaaaggtagatggagagactgcatcggacagtgagagccgggcagaatccgcacccctgccagtctctgcagatgataccccggaggtcctcaatagggccctttccaacttgtcttcaagatggaagaactggtgggtgagaggcatcctgactttggccatgattgcatttttcttcatcatcatttacctgggaccaatggttttgatgataatcgtgatgtgcgttcagattaagtgtttccatgagataatcactattggctacaacgtctaccactcatatgatctgccctggttcaggacgctcagctggtactttctcctgtgtgtaaactatttcttctatggtgagacagtgacggattacttcttcaccctggtccagagagaagagcctttgcggattctcagtaaataccaccggttcatttcctttactctctatctaataggattctgcatgtttgtactgagtctggtcaagaagcattatcgactgcagttctacatgtttggctggacccatgtgacattgctgattgttgtaacacagtcacatcttgttatccacaacctatttgaaggaatgatctggttcattgtccccatatcttgtgtgatctgtaatgacatcatggcctatatgtttggctttttctttggtcggaccccactcatcaagctgtccccgaagaagacctgggaaggcttcattgggggcttctttgctactgtggtgtttggccttctgctgtcctatgtgatgtccgggtacagatgctttgtctgccctgtggagtacaacaatgacaccaacagcttcactgtggactgtgagccctcggacctgtttcgcctgcaggagtacaacattcctggggtgatccagtcagtcattggctggaaaacggtccggatgtaccccttccagattcacagcatcgctctctccacctttgcctcgctcattggcccctttggaggattcttcgcaagtggattcaaacgagcctttaaaatcaaagactttgccaataccattcctggccatggaggcatcatggatcgctttgactgccagtatctgatggccacctttgtcaatgtatacatcgccagttttatcagaggccctaacccaagcaaactgattcagcagttcctgactttacggccagatcagcagctccacatcttcaacacgctgcggtctcatctgatcgacaaagggatgctgacatccaccacagaggacgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: