Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FIGF-c-fos induced growth factor (vascular endothelial growth factor D) Gene
PTXBC027948
New product
Data sheet of FIGF-c-fos induced growth factor (vascular endothelial growth factor D) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FIGF-c-fos induced growth factor (vascular endothelial growth factor D) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027948 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FIGF |
| Origin species: | Human |
| Product name: | FIGF-c-fos induced growth factor (vascular endothelial growth factor D) Gene |
| Size: | 2ug |
| Accessions: | BC027948 |
| Gene id: | 2277 |
| Gene description: | c-fos induced growth factor (vascular endothelial growth factor D) |
| Synonyms: | FIGF; VEGF-D; vascular endothelial growth factor D; c-fos induced growth factor (vascular endothelial growth factor D) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtacagagagtgggtagtggtgaatgttttcatgatgttgtacgtccagctggtgcagggctccagtaatgaacatggaccagtgaagcgatcatctcagtccacattggaacgatctgaacagcagatcagggctgcttctagtttggaggaactacttcgaattactcactctgaggactggaagctgtggagatgcaggctgaggctcaaaagttttaccagtatggactctcgctcagcatcccatcggtccactaggtttgcggcaactttctatgacattgaaacactaaaagttatagatgaagaatggcaaagaactcagtgcagccctagagaaacgtgcgtggaggtggccagtgagctggggaagagtaccaacacattcttcaagcccccttgtgtgaacgtgttccgatgtggtggctgttgcaatgaagagagccttatctgtatgaacaccagcacctcgtacatttccaaacagctctttgagatatcagtgcctttgacatcagtacctgaattagtgcctgttaaagttgccaatcatacaggttgtaagtgcttgccaacagccccccgccatccatactcaattatcagaagatccatccagatccctgaagaagatcgctgttcccattccaagaaactctgtcctattgacatgctatgggatagcaacaaatgtaaatgtgttttgcaggaggaaaatccacttgctggaacagaagaccactctcatctccaggaaccagctctctgtgggccacacatgatgtttgacgaagatcgttgcgagtgtgtctgtaaaacaccatgtcccaaagatctaatccagcaccccaaaaactgcagttgctttgagtgcaaagaaagtctggagacctgctgccagaagcacaagctatttcacccagacacctgcagctgtgaggacagatgcccctttcataccagaccatgtgcaagtggcaaaacagcatgtgcaaagcattgccgctttccaaaggagaaaagggctgcccaggggccccacagccgaaagaatccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ganglioside-induced differentiation-associated protein 1-like 1 - CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 - NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae) - disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) |