FIGF-c-fos induced growth factor (vascular endothelial growth factor D) Gene View larger

FIGF-c-fos induced growth factor (vascular endothelial growth factor D) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FIGF-c-fos induced growth factor (vascular endothelial growth factor D) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FIGF-c-fos induced growth factor (vascular endothelial growth factor D) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027948
Product type: DNA & cDNA
Ncbi symbol: FIGF
Origin species: Human
Product name: FIGF-c-fos induced growth factor (vascular endothelial growth factor D) Gene
Size: 2ug
Accessions: BC027948
Gene id: 2277
Gene description: c-fos induced growth factor (vascular endothelial growth factor D)
Synonyms: FIGF; VEGF-D; vascular endothelial growth factor D; c-fos induced growth factor (vascular endothelial growth factor D)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtacagagagtgggtagtggtgaatgttttcatgatgttgtacgtccagctggtgcagggctccagtaatgaacatggaccagtgaagcgatcatctcagtccacattggaacgatctgaacagcagatcagggctgcttctagtttggaggaactacttcgaattactcactctgaggactggaagctgtggagatgcaggctgaggctcaaaagttttaccagtatggactctcgctcagcatcccatcggtccactaggtttgcggcaactttctatgacattgaaacactaaaagttatagatgaagaatggcaaagaactcagtgcagccctagagaaacgtgcgtggaggtggccagtgagctggggaagagtaccaacacattcttcaagcccccttgtgtgaacgtgttccgatgtggtggctgttgcaatgaagagagccttatctgtatgaacaccagcacctcgtacatttccaaacagctctttgagatatcagtgcctttgacatcagtacctgaattagtgcctgttaaagttgccaatcatacaggttgtaagtgcttgccaacagccccccgccatccatactcaattatcagaagatccatccagatccctgaagaagatcgctgttcccattccaagaaactctgtcctattgacatgctatgggatagcaacaaatgtaaatgtgttttgcaggaggaaaatccacttgctggaacagaagaccactctcatctccaggaaccagctctctgtgggccacacatgatgtttgacgaagatcgttgcgagtgtgtctgtaaaacaccatgtcccaaagatctaatccagcaccccaaaaactgcagttgctttgagtgcaaagaaagtctggagacctgctgccagaagcacaagctatttcacccagacacctgcagctgtgaggacagatgcccctttcataccagaccatgtgcaagtggcaaaacagcatgtgcaaagcattgccgctttccaaaggagaaaagggctgcccaggggccccacagccgaaagaatccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ganglioside-induced differentiation-associated protein 1-like 1
- CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
- NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)
- disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)

Buy FIGF-c-fos induced growth factor (vascular endothelial growth factor D) Gene now

Add to cart