Login to display prices
Login to display prices
FIGF-c-fos induced growth factor (vascular endothelial growth factor D) Gene View larger

FIGF-c-fos induced growth factor (vascular endothelial growth factor D) Gene

PTXBC027948

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FIGF-c-fos induced growth factor (vascular endothelial growth factor D) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FIGF-c-fos induced growth factor (vascular endothelial growth factor D) Gene

Proteogenix catalog: PTXBC027948
Ncbi symbol: FIGF
Product name: FIGF-c-fos induced growth factor (vascular endothelial growth factor D) Gene
Size: 2ug
Accessions: BC027948
Gene id: 2277
Gene description: c-fos induced growth factor (vascular endothelial growth factor D)
Synonyms: FIGF; VEGF-D; vascular endothelial growth factor D; c-fos induced growth factor (vascular endothelial growth factor D)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtacagagagtgggtagtggtgaatgttttcatgatgttgtacgtccagctggtgcagggctccagtaatgaacatggaccagtgaagcgatcatctcagtccacattggaacgatctgaacagcagatcagggctgcttctagtttggaggaactacttcgaattactcactctgaggactggaagctgtggagatgcaggctgaggctcaaaagttttaccagtatggactctcgctcagcatcccatcggtccactaggtttgcggcaactttctatgacattgaaacactaaaagttatagatgaagaatggcaaagaactcagtgcagccctagagaaacgtgcgtggaggtggccagtgagctggggaagagtaccaacacattcttcaagcccccttgtgtgaacgtgttccgatgtggtggctgttgcaatgaagagagccttatctgtatgaacaccagcacctcgtacatttccaaacagctctttgagatatcagtgcctttgacatcagtacctgaattagtgcctgttaaagttgccaatcatacaggttgtaagtgcttgccaacagccccccgccatccatactcaattatcagaagatccatccagatccctgaagaagatcgctgttcccattccaagaaactctgtcctattgacatgctatgggatagcaacaaatgtaaatgtgttttgcaggaggaaaatccacttgctggaacagaagaccactctcatctccaggaaccagctctctgtgggccacacatgatgtttgacgaagatcgttgcgagtgtgtctgtaaaacaccatgtcccaaagatctaatccagcaccccaaaaactgcagttgctttgagtgcaaagaaagtctggagacctgctgccagaagcacaagctatttcacccagacacctgcagctgtgaggacagatgcccctttcataccagaccatgtgcaagtggcaaaacagcatgtgcaaagcattgccgctttccaaaggagaaaagggctgcccaggggccccacagccgaaagaatccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: