TFAP4-transcription factor AP-4 (activating enhancer binding protein 4) Gene View larger

TFAP4-transcription factor AP-4 (activating enhancer binding protein 4) Gene

PTXBC010576

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TFAP4-transcription factor AP-4 (activating enhancer binding protein 4) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TFAP4-transcription factor AP-4 (activating enhancer binding protein 4) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010576
Product type: DNA & cDNA
Ncbi symbol: TFAP4
Origin species: Human
Product name: TFAP4-transcription factor AP-4 (activating enhancer binding protein 4) Gene
Size: 2ug
Accessions: BC010576
Gene id: 7023
Gene description: transcription factor AP-4 (activating enhancer binding protein 4)
Synonyms: AP-4; bHLHc41; transcription factor AP-4; activating enhancer-binding protein 4; class C basic helix-loop-helix protein 41; transcription factor AP-4 (activating enhancer binding protein 4)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtatttcatggtgcccactcagaaggtgccctctttgcaacatttcaggaaaacagagaaagaagtgataggagggctctgtagccttgccaacattccactaacccccgagactcagcgggaccaggagcggcggattcggcgggagatcgccaacagcaacgagcggagacgcatgcagagcatcaacgcgggattccagtccctcaagaccctcatcccccacacagacggagagaagctcagcaaggcagccattctccagcagacagccgagtacatcttctccctggagcaggagaagaccaggctcttgcagcagaacacacagctcaagcgcttcatccaggagctgagcggctcgtcccccaagcgacggcgggcagaggacaaggacgaaggcataggctccccggacatctgggaggacgagaaggcggaggacctgcggcgggagatgattgagctgcggcagcagctggacaaggagcgctcggtgcgcatgatgctggaggagcaggtgcgctcgctggaggcccacatgtacccggaaaagctcaaggtgattgcgcagcaggtgcagctgcagcagcagcaggaacaggtgaggctgctgcaccaggagaagctggagcgggaacagcagcagctgcggacccagcttctgccccctccggcccccacccaccaccccacggtgatcgtgccagcaccgcctcctcctccctcccaccacatcaatgtcgtcaccatgggcccctcctcggtcatcaactctgtttccacatcccggcaaaatctggacaccatcgtgcaggcaatccagcacatcgagggcacccaggaaaagcaggagctggaggaggagcagcggcgagctgtcatcgtgaagcctgtccgcagctgcccggaggcccccacctctgacaccgcctccgactccgaggcctcagacagtgacgccatggaccagagccgggaggagccgtcgggggacggggagcttccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - guanine nucleotide binding protein (G protein), beta polypeptide 2
- guanine nucleotide binding protein (G protein), beta polypeptide 4
- guanine nucleotide binding protein (G protein), beta polypeptide 1
- c-fos induced growth factor (vascular endothelial growth factor D)

Buy TFAP4-transcription factor AP-4 (activating enhancer binding protein 4) Gene now

Add to cart