Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TFAP4-transcription factor AP-4 (activating enhancer binding protein 4) Gene
PTXBC010576
New product
Data sheet of TFAP4-transcription factor AP-4 (activating enhancer binding protein 4) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TFAP4-transcription factor AP-4 (activating enhancer binding protein 4) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010576 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TFAP4 |
| Origin species: | Human |
| Product name: | TFAP4-transcription factor AP-4 (activating enhancer binding protein 4) Gene |
| Size: | 2ug |
| Accessions: | BC010576 |
| Gene id: | 7023 |
| Gene description: | transcription factor AP-4 (activating enhancer binding protein 4) |
| Synonyms: | AP-4; bHLHc41; transcription factor AP-4; activating enhancer-binding protein 4; class C basic helix-loop-helix protein 41; transcription factor AP-4 (activating enhancer binding protein 4) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagtatttcatggtgcccactcagaaggtgccctctttgcaacatttcaggaaaacagagaaagaagtgataggagggctctgtagccttgccaacattccactaacccccgagactcagcgggaccaggagcggcggattcggcgggagatcgccaacagcaacgagcggagacgcatgcagagcatcaacgcgggattccagtccctcaagaccctcatcccccacacagacggagagaagctcagcaaggcagccattctccagcagacagccgagtacatcttctccctggagcaggagaagaccaggctcttgcagcagaacacacagctcaagcgcttcatccaggagctgagcggctcgtcccccaagcgacggcgggcagaggacaaggacgaaggcataggctccccggacatctgggaggacgagaaggcggaggacctgcggcgggagatgattgagctgcggcagcagctggacaaggagcgctcggtgcgcatgatgctggaggagcaggtgcgctcgctggaggcccacatgtacccggaaaagctcaaggtgattgcgcagcaggtgcagctgcagcagcagcaggaacaggtgaggctgctgcaccaggagaagctggagcgggaacagcagcagctgcggacccagcttctgccccctccggcccccacccaccaccccacggtgatcgtgccagcaccgcctcctcctccctcccaccacatcaatgtcgtcaccatgggcccctcctcggtcatcaactctgtttccacatcccggcaaaatctggacaccatcgtgcaggcaatccagcacatcgagggcacccaggaaaagcaggagctggaggaggagcagcggcgagctgtcatcgtgaagcctgtccgcagctgcccggaggcccccacctctgacaccgcctccgactccgaggcctcagacagtgacgccatggaccagagccgggaggagccgtcgggggacggggagcttccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), beta polypeptide 2 - guanine nucleotide binding protein (G protein), beta polypeptide 4 - guanine nucleotide binding protein (G protein), beta polypeptide 1 - c-fos induced growth factor (vascular endothelial growth factor D) |