Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PRPF38A-PRP38 pre-mRNA processing factor 38 (yeast) domain containing A Gene
PTXBC000777
New product
Data sheet of PRPF38A-PRP38 pre-mRNA processing factor 38 (yeast) domain containing A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRPF38A-PRP38 pre-mRNA processing factor 38 (yeast) domain containing A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000777 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRPF38A |
| Origin species: | Human |
| Product name: | PRPF38A-PRP38 pre-mRNA processing factor 38 (yeast) domain containing A Gene |
| Size: | 2ug |
| Accessions: | BC000777 |
| Gene id: | 84950 |
| Gene description: | PRP38 pre-mRNA processing factor 38 (yeast) domain containing A |
| Synonyms: | PRP38A; Prp38; pre-mRNA-splicing factor 38A; PRP38 pre-mRNA processing factor 38 domain containing A; pre-mRNA processing factor 38A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgatgtggagtccagtgaagaggaagaagaggaggatgagaagttggaaagagtgccatcacctgatcaccgccggagaagctaccgagacttggacaagccccgtcgctctcccacactgcgctacaggaggagtaggagccggtctcccagaaggcggagtcgatctcccaaaaggagaagcccctcccctcgccgagaaaggcatcggagcaagagtccaagacgtcaccgcagcaggtcccgagatcggcggcacagatcccgttccaagtccccaggtcatcaccgtagtcacagacacaggagccactcaaagtctcccgaaaggtctaagaagagccacaagaagagccggagagggaatgagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) - v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) - transcription factor AP-4 (activating enhancer binding protein 4) - guanine nucleotide binding protein (G protein), beta polypeptide 2 |