Login to display prices
Login to display prices
PRPF38A-PRP38 pre-mRNA processing factor 38 (yeast) domain containing A Gene View larger

PRPF38A-PRP38 pre-mRNA processing factor 38 (yeast) domain containing A Gene

PTXBC000777

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRPF38A-PRP38 pre-mRNA processing factor 38 (yeast) domain containing A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRPF38A-PRP38 pre-mRNA processing factor 38 (yeast) domain containing A Gene

Proteogenix catalog: PTXBC000777
Ncbi symbol: PRPF38A
Product name: PRPF38A-PRP38 pre-mRNA processing factor 38 (yeast) domain containing A Gene
Size: 2ug
Accessions: BC000777
Gene id: 84950
Gene description: PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
Synonyms: PRP38A; Prp38; pre-mRNA-splicing factor 38A; PRP38 pre-mRNA processing factor 38 domain containing A; pre-mRNA processing factor 38A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgatgtggagtccagtgaagaggaagaagaggaggatgagaagttggaaagagtgccatcacctgatcaccgccggagaagctaccgagacttggacaagccccgtcgctctcccacactgcgctacaggaggagtaggagccggtctcccagaaggcggagtcgatctcccaaaaggagaagcccctcccctcgccgagaaaggcatcggagcaagagtccaagacgtcaccgcagcaggtcccgagatcggcggcacagatcccgttccaagtccccaggtcatcaccgtagtcacagacacaggagccactcaaagtctcccgaaaggtctaagaagagccacaagaagagccggagagggaatgagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: