Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UCHL1-ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) Gene
PTXBC000332
New product
Data sheet of UCHL1-ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UCHL1-ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000332 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UCHL1 |
| Origin species: | Human |
| Product name: | UCHL1-ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) Gene |
| Size: | 2ug |
| Accessions: | BC000332 |
| Gene id: | 7345 |
| Gene description: | ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) |
| Synonyms: | HEL-117; HEL-S-53; NDGOA; PARK5; PGP 9.5; PGP9.5; PGP95; Uch-L1; ubiquitin carboxyl-terminal hydrolase isozyme L1; epididymis luminal protein 117; epididymis secretory protein Li 53; neuron cytoplasmic protein 9.5; ubiquitin C-terminal hydrolase; ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase); ubiquitin thioesterase L1; ubiquitin thiolesterase; ubiquitin C-terminal hydrolase L1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagctcaagccgatggagatcaaccccgagatgctgaacaaagtgctgtcccggctgggggtcgccggccagtggcgcttcgtggacgtgctggggctggaagaggagtctctgggctcggtgccagcgcctgcctgcgcgctgctgctgctgtttcccctcacggcccagcatgagaacttcaggaaaaagcagattgaagagctgaagggacaagaagttagtcctaaagtgtacttcatgaagcagaccattgggaattcctgtggcacaatcggacttattcacgcagtggccaataatcaagacaaactgggatttgaggatggatcagttctgaaacagtttctttctgaaacagagaaaatgtcccctgaagacagagcaaaatgctttgaaaagaatgaggccatacaggcagcccatgatgccgtggcacaggaaggccaatgtcgggtagatgacaaggtgaatttccattttattctgtttaacaacgtggatggccacctctatgaacttgatggacgaatgccttttccggtgaaccatggcgccagttcagaggacaccctgctgaaggacgctgccaaggtctgcagagaattcaccgagcgtgagcaaggagaagtccgcttctctgccgtggctctctgcaaggcagcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) - transcription factor AP-4 (activating enhancer binding protein 4) - guanine nucleotide binding protein (G protein), beta polypeptide 2 - guanine nucleotide binding protein (G protein), beta polypeptide 4 |