IMMP2L-IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene View larger

IMMP2L-IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene

PTXBC008497

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IMMP2L-IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IMMP2L-IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008497
Product type: DNA & cDNA
Ncbi symbol: IMMP2L
Origin species: Human
Product name: IMMP2L-IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene
Size: 2ug
Accessions: BC008497
Gene id: 83943
Gene description: IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Synonyms: IMMP2L-IT1; IMP2; IMP2-LIKE; mitochondrial inner membrane protease subunit 2; IMP2 inner mitochondrial membrane peptidase-like; IMP2 inner mitochondrial membrane protease-like; inner mitochondrial membrane peptidase 2 like; inner mitochondrial membrane peptidase subunit 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacagtcacaagggtgggtgaaaagatacatcaaggccttttgtaaaggcttctttgtggcggtgcctgtggcagtgactttcttggatcgggtcgcctgtgtggcaagagtagaaggagcatcgatgcagccttctttgaatcctggggggagccagtcatctgatgtggtgcttttgaaccactggaaagtgaggaattttgaagtacaccgtggtgacattgtatcattggtgtctcctaaaaacccagaacagaagatcattaagagagtgattgctcttgaaggagatattgtcagagatgggagaaaactgaaaaggatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitogen-activated protein kinase 1 interacting protein 1-like
- BMP and activin membrane-bound inhibitor homolog (Xenopus laevis)
- Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
- PAX interacting (with transcription-activation domain) protein 1

Buy IMMP2L-IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene now

Add to cart