Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
IMMP2L-IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene
PTXBC008497
New product
Data sheet of IMMP2L-IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IMMP2L-IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008497 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IMMP2L |
| Origin species: | Human |
| Product name: | IMMP2L-IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC008497 |
| Gene id: | 83943 |
| Gene description: | IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) |
| Synonyms: | IMMP2L-IT1; IMP2; IMP2-LIKE; mitochondrial inner membrane protease subunit 2; IMP2 inner mitochondrial membrane peptidase-like; IMP2 inner mitochondrial membrane protease-like; inner mitochondrial membrane peptidase 2 like; inner mitochondrial membrane peptidase subunit 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcacagtcacaagggtgggtgaaaagatacatcaaggccttttgtaaaggcttctttgtggcggtgcctgtggcagtgactttcttggatcgggtcgcctgtgtggcaagagtagaaggagcatcgatgcagccttctttgaatcctggggggagccagtcatctgatgtggtgcttttgaaccactggaaagtgaggaattttgaagtacaccgtggtgacattgtatcattggtgtctcctaaaaacccagaacagaagatcattaagagagtgattgctcttgaaggagatattgtcagagatgggagaaaactgaaaaggatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitogen-activated protein kinase 1 interacting protein 1-like - BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) - Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) - PAX interacting (with transcription-activation domain) protein 1 |