Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GNB3-guanine nucleotide binding protein (G protein), beta polypeptide 3 Gene
PTXBC015920
New product
Data sheet of GNB3-guanine nucleotide binding protein (G protein), beta polypeptide 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNB3-guanine nucleotide binding protein (G protein), beta polypeptide 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015920 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNB3 |
| Origin species: | Human |
| Product name: | GNB3-guanine nucleotide binding protein (G protein), beta polypeptide 3 Gene |
| Size: | 2ug |
| Accessions: | BC015920 |
| Gene id: | 2784 |
| Gene description: | guanine nucleotide binding protein (G protein), beta polypeptide 3 |
| Synonyms: | CSNB1H; guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3; G protein, beta-3 subunit; GTP-binding regulatory protein beta-3 chain; guanine nucleotide binding protein (G protein), beta polypeptide 3; guanine nucleotide-binding protein G(I)/G(S)/G(T) beta subunit 3; hypertension associated protein; transducin beta chain 3; G protein subunit beta 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggggagatggagcaactgcgtcaggaagcggagcagctcaagaagcagattgcagatgccaggaaagcctgtgctgacgttactctggcagagctggtgtctggcctagaggtggtgggacgagtccagatgcggacgcggcggacgttaaggggacacctggccaagatttacgccatgcactgggccactgattctaagctgctggtaagtgcctcgcaagatgggaagctgatcgtgtgggacagctacaccaccaacaaggtgcacgccatcccactgcgctcctcctgggtcatgacctgtgcctatgccccatcagggaactttgtggcatgtggggggctggacaacatgtgttccatctacaacctcaaatcccgtgagggcaatgtcaaggtcagccgggagctttctgctcacacaggttatctctcctgctgccgcttcctggatgacaacaatattgtgaccagctcgggggacaccacgtgtgccttgtgggacattgagactgggcagcagaagactgtatttgtgggacacacgggtgactgcatgagcctggctgtgtctcctgacttcaatctcttcatttcgggggcctgtgatgccagtgccaagctctgggatgtgcgagaggggacctgccgtcagactttcactggccacgagtcggacatcaacgccatctgtttcttctccctcagtggccgcctactattcgctggctacgacgacttcaactgcaatgtctgggactccatgaagtctgagcgtgtgggcatcctctctggccacgataacagggtgagctgcctgggagtcacagctgacgggatggctgtggccacaggttcctgggacagcttcctcaaaatctggaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), beta polypeptide 2 - ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) - integrin-linked kinase-associated serine/threonine phosphatase 2C - solute carrier family 40 (iron-regulated transporter), member 1 |