GNB3-guanine nucleotide binding protein (G protein), beta polypeptide 3 Gene View larger

GNB3-guanine nucleotide binding protein (G protein), beta polypeptide 3 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNB3-guanine nucleotide binding protein (G protein), beta polypeptide 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GNB3-guanine nucleotide binding protein (G protein), beta polypeptide 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015920
Product type: DNA & cDNA
Ncbi symbol: GNB3
Origin species: Human
Product name: GNB3-guanine nucleotide binding protein (G protein), beta polypeptide 3 Gene
Size: 2ug
Accessions: BC015920
Gene id: 2784
Gene description: guanine nucleotide binding protein (G protein), beta polypeptide 3
Synonyms: CSNB1H; guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3; G protein, beta-3 subunit; GTP-binding regulatory protein beta-3 chain; guanine nucleotide binding protein (G protein), beta polypeptide 3; guanine nucleotide-binding protein G(I)/G(S)/G(T) beta subunit 3; hypertension associated protein; transducin beta chain 3; G protein subunit beta 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggggagatggagcaactgcgtcaggaagcggagcagctcaagaagcagattgcagatgccaggaaagcctgtgctgacgttactctggcagagctggtgtctggcctagaggtggtgggacgagtccagatgcggacgcggcggacgttaaggggacacctggccaagatttacgccatgcactgggccactgattctaagctgctggtaagtgcctcgcaagatgggaagctgatcgtgtgggacagctacaccaccaacaaggtgcacgccatcccactgcgctcctcctgggtcatgacctgtgcctatgccccatcagggaactttgtggcatgtggggggctggacaacatgtgttccatctacaacctcaaatcccgtgagggcaatgtcaaggtcagccgggagctttctgctcacacaggttatctctcctgctgccgcttcctggatgacaacaatattgtgaccagctcgggggacaccacgtgtgccttgtgggacattgagactgggcagcagaagactgtatttgtgggacacacgggtgactgcatgagcctggctgtgtctcctgacttcaatctcttcatttcgggggcctgtgatgccagtgccaagctctgggatgtgcgagaggggacctgccgtcagactttcactggccacgagtcggacatcaacgccatctgtttcttctccctcagtggccgcctactattcgctggctacgacgacttcaactgcaatgtctgggactccatgaagtctgagcgtgtgggcatcctctctggccacgataacagggtgagctgcctgggagtcacagctgacgggatggctgtggccacaggttcctgggacagcttcctcaaaatctggaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - guanine nucleotide binding protein (G protein), beta polypeptide 2
- ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
- integrin-linked kinase-associated serine/threonine phosphatase 2C
- solute carrier family 40 (iron-regulated transporter), member 1

Buy GNB3-guanine nucleotide binding protein (G protein), beta polypeptide 3 Gene now

Add to cart