Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DR1-down-regulator of transcription 1, TBP-binding (negative cofactor 2) Gene
PTXBC002809
New product
Data sheet of DR1-down-regulator of transcription 1, TBP-binding (negative cofactor 2) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DR1-down-regulator of transcription 1, TBP-binding (negative cofactor 2) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002809 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DR1 |
| Origin species: | Human |
| Product name: | DR1-down-regulator of transcription 1, TBP-binding (negative cofactor 2) Gene |
| Size: | 2ug |
| Accessions: | BC002809 |
| Gene id: | 1810 |
| Gene description: | down-regulator of transcription 1, TBP-binding (negative cofactor 2) |
| Synonyms: | protein Dr1; NC2; NC2-BETA; NC2B; TATA-binding protein-associated phosphoprotein; negative cofactor 2; negative cofactor 2-beta; down-regulator of transcription 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttcctcgtctggcaacgatgatgatctcactatccccagagctgctatcaataaaatgatcaaagagactcttcctaatgtccgggtggccaacgatgctcgagagctggtggtgaactgctgcactgaattcattcaccttatatcttctgaagccaatgagatttgtaacaaatcggaaaagaagaccatctcaccagagcatgtcatacaagcactagaaagtttgggatttggctcttacatcagtgaagtaaaagaagtcttgcaagagtgtaaaacagtagcattaaaaagaagaaaggccagttctcgtttggaaaaccttggcattcctgaagaagagttattgagacagcaacaagaattatttgcaaaagctagacagcaacaagcagaattggcccaacaggaatggcttcaaatgcagcaagctgcccaacaagcccagcttgctgctgcctcagccagtgcatctaatcaggcgggatcttctcaggatgaagaagatgatgatgatatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transient receptor potential cation channel, subfamily V, member 2 - methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like - ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) - eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) |