PDS5B-PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) Gene View larger

PDS5B-PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) Gene

PTXBC039256

New product

Data sheet of PDS5B-PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDS5B-PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC039256
Product type: DNA & cDNA
Ncbi symbol: PDS5B
Origin species: Human
Product name: PDS5B-PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) Gene
Size: 2ug
Accessions: BC039256
Gene id: 23047
Gene description: PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
Synonyms: APRIN; AS3; CG008; sister chromatid cohesion protein PDS5 homolog B; androgen induced inhibitor of proliferation; androgen-induced proliferation inhibitor; androgen-induced prostate proliferative shutoff-associated protein AS3; androgen-induced shutoff 3; PDS5 cohesin associated factor B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcattcaaagactaggaccaatgatggaaaaattacatatccgcctggggtcaaggaaatatcagataaaatatctaaagaggagatggtgagacgattaaagatggttgtgaaaacttttatggatatggaccaggactctgaagaagaaaaggagctttatttaaacctagctttacatcttgcttcagatttttttctcaagcatcctgataaagatgttcgcttactggtagcctgctgccttgctgatattttcaggatttatgctcctgaagctccttacacatcccctgataaactaaaggatatatttatgtttataacaagacagttgaaggggctagaggatacaaagagcccacaattcaataggtatttttatttacttgagaacattgcttgggtcaagtcatataacatatgctttgagttagaagatagcaatgaaattttcacccagctatacagaaccttattttcagttataaacaatggccacaatcagaaagtccatatgcacatggtagaccttatgagctctattatttgtgaaggtgatacagtgtctcaggagcttttggatacggttttagtaaatctggtacctgctcataagaatttaaacaagcaagcatatgatttggcaaaggctttactgaagaggacagctcaagctattgagccatatattaccaatttttttaatcaggttctgatgcttgggaaaacatctatcagcgatttgtcagagcatgtctttgacttaattttggagctctacaatattgatagtcatttgctgctctctgttttaccccagcttgaatttaaattaaagagcaatgataatgaggagcgcctacaagttgttaaactactggcaaaaatgtttggggcaaaggattcagaattggcttctcaaaacaagccactttggcagtgctacttgggcaggtttaatgatatcaatgtaccaatccgcctggaatgtgtgaaatttgctagccattgtctcatgaaccatcctgatttagcaaaagacttaacagagtatcttaaagtgaggtcacatgaccctgaggaagctattagacatgatgttattgtgtcaatagttacagctgctaaaaaggatattcttctggtcaatgatcacttacttaattttgtgagagagagaacattagacaaacgatggagagtacgcaaagaagccatgatgggacttgcccaaatttataagaaatatgctttacagtcagcagctggaaaagatgctgcaaaacagatagcatggatcaaagacaaattgctacatatatattatcaaaatagtattgatgatcgactacttgttgaacggatctttgctcaatacatggttcctcacaatttagaaactacagaacggatgaaatgcttatattacttgtatgccacactggatttaaatgctgtgaagtatgtttcaaatatcaaattctgttcttttcatcctttgcaatatattggattttatggaaaagaaactacaaacacctgtattttaaaatgtaatctatgtagtgtaaacattgtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - inositol 1,4,5-triphosphate receptor interacting protein-like 1
- NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa
- translocase of inner mitochondrial membrane 17 homolog A (yeast)
- down-regulator of transcription 1, TBP-binding (negative cofactor 2)

Buy PDS5B-PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) Gene now

Add to cart