Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFC2-NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa Gene
PTXBC007323
New product
Data sheet of NDUFC2-NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFC2-NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007323 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFC2 |
| Origin species: | Human |
| Product name: | NDUFC2-NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa Gene |
| Size: | 2ug |
| Accessions: | BC007323 |
| Gene id: | 4718 |
| Gene description: | NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa |
| Synonyms: | B14.5b; CI-B14.5b; HLC-1; NADHDH2; NADH dehydrogenase [ubiquinone] 1 subunit C2; NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa; NADH-ubiquinone oxidoreductase subunit B14.5b; complex I subunit B14.5b; complex I-B14.5b; human lung cancer oncogene 1 protein; NADH:ubiquinone oxidoreductase subunit C2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcgcacggcggaacccagaacccttacggtttctgccggatgaggcccggagcctgcccccgcccaagctgaccgacccgcggctcctctacatcggcttcttgggctactgctccggcctgattgataacctgatccggcggaggccgatcgcgacggctggtttgcatcgccagcttctatatattacggcctttttttttgctggatattatcttgtaaaacgtgaagactacctgtatgctgtgagggaccgtgaaatgtttggatatatgaaattacatccagaggattttcctgaagaagataagaaaacatatggtgaaatttttgaaaaattccatccaatacgttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - translocase of inner mitochondrial membrane 17 homolog A (yeast) - down-regulator of transcription 1, TBP-binding (negative cofactor 2) - transient receptor potential cation channel, subfamily V, member 2 - methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like |