IGF2-insulin-like growth factor 2 (somatomedin A) Gene View larger

IGF2-insulin-like growth factor 2 (somatomedin A) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IGF2-insulin-like growth factor 2 (somatomedin A) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IGF2-insulin-like growth factor 2 (somatomedin A) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000531
Product type: DNA & cDNA
Ncbi symbol: IGF2
Origin species: Human
Product name: IGF2-insulin-like growth factor 2 (somatomedin A) Gene
Size: 2ug
Accessions: BC000531
Gene id: 3481
Gene description: insulin-like growth factor 2 (somatomedin A)
Synonyms: C11orf43; GRDF; IGF-II; PP9974; insulin-like growth factor II; T3M-11-derived growth factor; insulin-like growth factor 2 (somatomedin A); insulin-like growth factor type 2; preptin; insulin like growth factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaatcccaatggggaagtcgatgctggtgcttctcaccttcttggccttcgcctcgtgctgcattgctgcttaccgccccagtgagaccctgtgcggcggggagctggtggacaccctccagttcgtctgtggggaccgcggcttctacttcagcaggcccgcaagccgtgtgagccgtcgcagccgtggcatcgttgaggagtgctgtttccgcagctgtgacctggccctcctggagacgtactgtgctacccccgccaagtccgagagggacgtgtcgacccctccgaccgtgcttccggacaacttccccagataccccgtgggcaagttcttccaatatgacacctggaagcagtccacccagcgcctgcgcaggggcctgcctgccctcctgcgtgcccgccggggtcacgtgctcgccaaggagctcgaggcgttcagggaggccaaacgtcaccgtcccctgattgctctacccacccaagaccccgcccacgggggcgcccccccagagatggccagcaatcggaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin-conjugating enzyme E2T (putative)
- Sjogren syndrome/scleroderma autoantigen 1
- dual specificity phosphatase 26 (putative)
- fibroblast growth factor binding protein 1

Buy IGF2-insulin-like growth factor 2 (somatomedin A) Gene now

Add to cart