Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of UBE2T-ubiquitin-conjugating enzyme E2T (putative) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2T-ubiquitin-conjugating enzyme E2T (putative) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004152 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2T |
| Origin species: | Human |
| Product name: | UBE2T-ubiquitin-conjugating enzyme E2T (putative) Gene |
| Size: | 2ug |
| Accessions: | BC004152 |
| Gene id: | 29089 |
| Gene description: | ubiquitin-conjugating enzyme E2T (putative) |
| Synonyms: | FANCT; HSPC150; PIG50; ubiquitin-conjugating enzyme E2 T; E2 ubiquitin-conjugating enzyme T; HSPC150 protein similar to ubiquitin-conjugating enzyme; cell proliferation-inducing gene 50 protein; ubiquitin carrier protein T; ubiquitin conjugating enzyme E2T; ubiquitin-conjugating enzyme E2T (putative); ubiquitin-protein ligase T; ubiquitin conjugating enzyme E2 T |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagagagcttcacgtctgaagagagagctgcacatgttagccacagagccacccccaggcatcacatgttggcaagataaagaccaaatggatgacctgcgagctcaaatattaggtggagccaacacaccttatgagaaaggtgtttttaagctagaagttatcattcctgagaggtacccatttgaacctcctcagatccgatttctcactccaatttatcatccaaacattgattctgctggaaggatttgtctggatgttctcaaattgccaccaaaaggtgcttggagaccatccctcaacatcgcaactgtgttgacctctattcagctgctcatgtcagaacccaaccctgatgacccgctcatggctgacatatcctcagaatttaaatataataagccagccttcctcaagaatgccagacagtggacagagaagcatgcaagacagaaacaaaaggctgatgaggaagagatgcttgataatctaccagaggctggtgactccagagtacacaactcaacacagaaaaggaaggccagtcagctagtaggcatagaaaagaaatttcatcctgatgtttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Sjogren syndrome/scleroderma autoantigen 1 - dual specificity phosphatase 26 (putative) - fibroblast growth factor binding protein 1 - phosphatidylethanolamine N-methyltransferase |