UBE2T-ubiquitin-conjugating enzyme E2T (putative) Gene View larger

UBE2T-ubiquitin-conjugating enzyme E2T (putative) Gene

PTXBC004152

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2T-ubiquitin-conjugating enzyme E2T (putative) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2T-ubiquitin-conjugating enzyme E2T (putative) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004152
Product type: DNA & cDNA
Ncbi symbol: UBE2T
Origin species: Human
Product name: UBE2T-ubiquitin-conjugating enzyme E2T (putative) Gene
Size: 2ug
Accessions: BC004152
Gene id: 29089
Gene description: ubiquitin-conjugating enzyme E2T (putative)
Synonyms: FANCT; HSPC150; PIG50; ubiquitin-conjugating enzyme E2 T; E2 ubiquitin-conjugating enzyme T; HSPC150 protein similar to ubiquitin-conjugating enzyme; cell proliferation-inducing gene 50 protein; ubiquitin carrier protein T; ubiquitin conjugating enzyme E2T; ubiquitin-conjugating enzyme E2T (putative); ubiquitin-protein ligase T; ubiquitin conjugating enzyme E2 T
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagagagcttcacgtctgaagagagagctgcacatgttagccacagagccacccccaggcatcacatgttggcaagataaagaccaaatggatgacctgcgagctcaaatattaggtggagccaacacaccttatgagaaaggtgtttttaagctagaagttatcattcctgagaggtacccatttgaacctcctcagatccgatttctcactccaatttatcatccaaacattgattctgctggaaggatttgtctggatgttctcaaattgccaccaaaaggtgcttggagaccatccctcaacatcgcaactgtgttgacctctattcagctgctcatgtcagaacccaaccctgatgacccgctcatggctgacatatcctcagaatttaaatataataagccagccttcctcaagaatgccagacagtggacagagaagcatgcaagacagaaacaaaaggctgatgaggaagagatgcttgataatctaccagaggctggtgactccagagtacacaactcaacacagaaaaggaaggccagtcagctagtaggcatagaaaagaaatttcatcctgatgtttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Sjogren syndrome/scleroderma autoantigen 1
- dual specificity phosphatase 26 (putative)
- fibroblast growth factor binding protein 1
- phosphatidylethanolamine N-methyltransferase

Buy UBE2T-ubiquitin-conjugating enzyme E2T (putative) Gene now

Add to cart