FGFBP1-fibroblast growth factor binding protein 1 Gene View larger

FGFBP1-fibroblast growth factor binding protein 1 Gene

PTXBC003628

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FGFBP1-fibroblast growth factor binding protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FGFBP1-fibroblast growth factor binding protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003628
Product type: DNA & cDNA
Ncbi symbol: FGFBP1
Origin species: Human
Product name: FGFBP1-fibroblast growth factor binding protein 1 Gene
Size: 2ug
Accessions: BC003628
Gene id: 9982
Gene description: fibroblast growth factor binding protein 1
Synonyms: FGF-BP; FGF-BP1; FGFBP; FGFBP-1; HBP17; fibroblast growth factor-binding protein 1; 17 kDa HBGF-binding protein; 17 kDa heparin-binding growth factor-binding protein; FGF-binding protein 1; heparin-binding growth factor binding protein; fibroblast growth factor binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagatctgtagcctcaccctgctctccttcctcctactggctgctcaggtgctcctggtggaggggaaaaaaaaagtgaagaatggacttcacagcaaagtggtctcagaacaaaaggacactctgggcaacacccagattaagcagaaaagcaggcccgggaacaaaggcaagtttgtcaccaaagaccaagccaactgcagatgggctgctactgagcaggaggagggcatctctctcaaggttgagtgcactcaattggaccatgaattttcctgtgtctttgctggcaatccaacctcatgcctaaagctcaaggatgagagagtctattggaaacaagttgcccggaatctgcgctcacagaaagacatctgtagatattccaagacagctgtgaaaaccagagtgtgcagaaaggattttccagaatccagtcttaagctagtcagctccactctatttgggaacacaaagcccaggaaggagaaaacagagatgtcccccagggagcacatcaagggcaaagagaccaccccctctagcctagcagtgacccagaccatggccaccaaagctcccgagtgtgtggaggacccagatatggcaaaccagaggaagactgccctggagttctgtggagagacttggagctctctctgcacattcttcctcagcatagtgcaggacacgtcatgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphatidylethanolamine N-methyltransferase
- mesoderm specific transcript homolog (mouse)
- proline-rich cyclin A1-interacting protein
- NAD(P) dependent steroid dehydrogenase-like

Buy FGFBP1-fibroblast growth factor binding protein 1 Gene now

Add to cart