Login to display prices
Login to display prices
PROCA1-proline-rich cyclin A1-interacting protein Gene View larger

PROCA1-proline-rich cyclin A1-interacting protein Gene

PTXBC029574

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PROCA1-proline-rich cyclin A1-interacting protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PROCA1-proline-rich cyclin A1-interacting protein Gene

Proteogenix catalog: PTXBC029574
Ncbi symbol: PROCA1
Product name: PROCA1-proline-rich cyclin A1-interacting protein Gene
Size: 2ug
Accessions: BC029574
Gene id: 147011
Gene description: proline-rich cyclin A1-interacting protein
Synonyms: protein PROCA1; proline-rich cyclin A1-interacting protein; protein interacting with cyclin A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgggtcaggacgacgctcacaattgaaagatggactaaggaaaagaccgagcccaaggcccgctcgtgggatgagagcagatgccgcggtgactgcaaggagcctgacaagtgctgctggagacacaagcagtgcactgggcacatcatctaccctttcgcctctgactgtgtccgccacagcctgcacctacactctgtcaaccactgcaactgtaattctaggctgaaggactcttcagaggatagcagcagctcccggggcgcgggcccaacctgctcccatgtcatcgagtccccttgctttgagctcacaccggaggaggagcatgtggagcgattccggtatggctggtgcaaaagctacagacctgtctctgtggcagtgatccaccatccactctaccatgagtgtggggcagatgatctaaatgaagaagaggaagaggaggaggaggaaagcaagccccccatcccgacacaggtggggcccgccaccgcctcccctgacctaggcaccagcatggccactggtacccctgactccacagcgcccatcaccatctggcgctctgagagccccacagggaagggtcagggcagcaaggtgatcaagaaggtaaagaagaaaaaggaaaaagagaaagacaaggaggagatggatgagaaggcaaagctgaagaaaaaagccaagaaaggccagttgactaagaagaaaagcccggttaaattggagccttccccgccagacgtgagccgatcattaagcgcaagacagctggccaggatgtccgagtccagcccagaaagccgggaagagctggagagcgaggacagttacaatggccgggggcagggagaactgtccagcgaggatattgtggaatcatcatcgcccaggaagagagagaacacagtccaggccaaaaagacaggggcaaagccctcacaagccaggaaggtaaacaagagaaaatctcccccaggatcaaaccccaacctcagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: