PROCA1-proline-rich cyclin A1-interacting protein Gene View larger

PROCA1-proline-rich cyclin A1-interacting protein Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PROCA1-proline-rich cyclin A1-interacting protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PROCA1-proline-rich cyclin A1-interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029574
Product type: DNA & cDNA
Ncbi symbol: PROCA1
Origin species: Human
Product name: PROCA1-proline-rich cyclin A1-interacting protein Gene
Size: 2ug
Accessions: BC029574
Gene id: 147011
Gene description: proline-rich cyclin A1-interacting protein
Synonyms: protein PROCA1; proline-rich cyclin A1-interacting protein; protein interacting with cyclin A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgggtcaggacgacgctcacaattgaaagatggactaaggaaaagaccgagcccaaggcccgctcgtgggatgagagcagatgccgcggtgactgcaaggagcctgacaagtgctgctggagacacaagcagtgcactgggcacatcatctaccctttcgcctctgactgtgtccgccacagcctgcacctacactctgtcaaccactgcaactgtaattctaggctgaaggactcttcagaggatagcagcagctcccggggcgcgggcccaacctgctcccatgtcatcgagtccccttgctttgagctcacaccggaggaggagcatgtggagcgattccggtatggctggtgcaaaagctacagacctgtctctgtggcagtgatccaccatccactctaccatgagtgtggggcagatgatctaaatgaagaagaggaagaggaggaggaggaaagcaagccccccatcccgacacaggtggggcccgccaccgcctcccctgacctaggcaccagcatggccactggtacccctgactccacagcgcccatcaccatctggcgctctgagagccccacagggaagggtcagggcagcaaggtgatcaagaaggtaaagaagaaaaaggaaaaagagaaagacaaggaggagatggatgagaaggcaaagctgaagaaaaaagccaagaaaggccagttgactaagaagaaaagcccggttaaattggagccttccccgccagacgtgagccgatcattaagcgcaagacagctggccaggatgtccgagtccagcccagaaagccgggaagagctggagagcgaggacagttacaatggccgggggcagggagaactgtccagcgaggatattgtggaatcatcatcgcccaggaagagagagaacacagtccaggccaaaaagacaggggcaaagccctcacaagccaggaaggtaaacaagagaaaatctcccccaggatcaaaccccaacctcagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NAD(P) dependent steroid dehydrogenase-like
- RAB3A interacting protein (rabin3)-like 1
- CD46 molecule, complement regulatory protein
- interleukin enhancer binding factor 2, 45kDa

Buy PROCA1-proline-rich cyclin A1-interacting protein Gene now

Add to cart