Login to display prices
Login to display prices
NSDHL-NAD(P) dependent steroid dehydrogenase-like Gene View larger

NSDHL-NAD(P) dependent steroid dehydrogenase-like Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NSDHL-NAD(P) dependent steroid dehydrogenase-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NSDHL-NAD(P) dependent steroid dehydrogenase-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000245
Product type: DNA & cDNA
Ncbi symbol: NSDHL
Origin species: Human
Product name: NSDHL-NAD(P) dependent steroid dehydrogenase-like Gene
Size: 2ug
Accessions: BC000245
Gene id: 50814
Gene description: NAD(P) dependent steroid dehydrogenase-like
Synonyms: H105E3; SDR31E1; XAP104; sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating; protein H105e3; short chain dehydrogenase/reductase family 31E, member 1; NAD(P) dependent steroid dehydrogenase-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaccagcagttagcgagccaatgagagaccaagtcgcacggactcatttgacagaggacactcccaaagtgaatgctgacatagaaaaggttaaccagaatcaggccaagagatgcacagtgatcgggggctctggattcctggggcagcacatggtggagcagttgctggcaagaggatatgctgtcaatgtatttgatatccagcaagggtttgataatccccaggtgcggttctttctgggtgacctctgcagccgacaggatctgtacccagctctgaaaggtgtaaacacagttttccactgtgcgtcacccccaccatccagtaacaacaaggagctcttttatagagtgaattacattggcaccaagaatgtcattgaaacttgcaaagaggctggggttcagaaactcattttaaccagcagtgccagtgtcatctttgagggcgtcgatatcaagaatggaactgaagaccttccctatgccatgaaacccattgactactacacagagactaagatcttacaggagagggcagttctgggcgccaacgatcctgagaagaatttcttaaccacagccatccgccctcatggcattttcggcccaagggacccgcagttggtacccatcctcatcgaggcagccaggaacggcaagatgaagttcgtgattggaaatgggaagaacttggtggacttcacctttgtggagaacgtggtccatggacacatcctggcggcagagcagctctcccgagactcgacactgggtgggaaggcatttcacatcaccaatgatgagcccatccctttctggacattcctgtctcgcatcctgacaggcctcaattatgaggcccccaagtaccacatcccctactgggtggcctactacctggccctcctgctatccctgctggtgatggtgatcagtcctgtcatccagctgcagcccaccttcacacccatgcgggtcgcactggctggcacattccactactacagctgcgagagagccaaaaaggccatgggctaccagccactagtgaccatggatgatgctatggagaggaccgtgcagagctttcgccacctgcggagggtcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB3A interacting protein (rabin3)-like 1
- CD46 molecule, complement regulatory protein
- interleukin enhancer binding factor 2, 45kDa
- tRNA nucleotidyl transferase, CCA-adding, 1