Cart 2 Product Products 226,80 € (empty)
-
1 x SSSCA1-Sjo...113,40 € -
1 x FGFBP1-fib...113,40 €
No products
To be determined Shipping
226,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 226,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 226,80 €
View larger 
Data sheet of NSDHL-NAD(P) dependent steroid dehydrogenase-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NSDHL-NAD(P) dependent steroid dehydrogenase-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000245 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NSDHL |
| Origin species: | Human |
| Product name: | NSDHL-NAD(P) dependent steroid dehydrogenase-like Gene |
| Size: | 2ug |
| Accessions: | BC000245 |
| Gene id: | 50814 |
| Gene description: | NAD(P) dependent steroid dehydrogenase-like |
| Synonyms: | H105E3; SDR31E1; XAP104; sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating; protein H105e3; short chain dehydrogenase/reductase family 31E, member 1; NAD(P) dependent steroid dehydrogenase-like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaccagcagttagcgagccaatgagagaccaagtcgcacggactcatttgacagaggacactcccaaagtgaatgctgacatagaaaaggttaaccagaatcaggccaagagatgcacagtgatcgggggctctggattcctggggcagcacatggtggagcagttgctggcaagaggatatgctgtcaatgtatttgatatccagcaagggtttgataatccccaggtgcggttctttctgggtgacctctgcagccgacaggatctgtacccagctctgaaaggtgtaaacacagttttccactgtgcgtcacccccaccatccagtaacaacaaggagctcttttatagagtgaattacattggcaccaagaatgtcattgaaacttgcaaagaggctggggttcagaaactcattttaaccagcagtgccagtgtcatctttgagggcgtcgatatcaagaatggaactgaagaccttccctatgccatgaaacccattgactactacacagagactaagatcttacaggagagggcagttctgggcgccaacgatcctgagaagaatttcttaaccacagccatccgccctcatggcattttcggcccaagggacccgcagttggtacccatcctcatcgaggcagccaggaacggcaagatgaagttcgtgattggaaatgggaagaacttggtggacttcacctttgtggagaacgtggtccatggacacatcctggcggcagagcagctctcccgagactcgacactgggtgggaaggcatttcacatcaccaatgatgagcccatccctttctggacattcctgtctcgcatcctgacaggcctcaattatgaggcccccaagtaccacatcccctactgggtggcctactacctggccctcctgctatccctgctggtgatggtgatcagtcctgtcatccagctgcagcccaccttcacacccatgcgggtcgcactggctggcacattccactactacagctgcgagagagccaaaaaggccatgggctaccagccactagtgaccatggatgatgctatggagaggaccgtgcagagctttcgccacctgcggagggtcaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAB3A interacting protein (rabin3)-like 1 - CD46 molecule, complement regulatory protein - interleukin enhancer binding factor 2, 45kDa - tRNA nucleotidyl transferase, CCA-adding, 1 |