Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CD46-CD46 molecule, complement regulatory protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD46-CD46 molecule, complement regulatory protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030594 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD46 |
| Origin species: | Human |
| Product name: | CD46-CD46 molecule, complement regulatory protein Gene |
| Size: | 2ug |
| Accessions: | BC030594 |
| Gene id: | 4179 |
| Gene description: | CD46 molecule, complement regulatory protein |
| Synonyms: | CD46 molecule; membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen); CD46 molecule, complement regulatory protein; CD46 antigen, complement regulatory protein; AHUS2; MCP; MIC10; TLX; TRA2.10; membrane cofactor protein; antigen identified by monoclonal antibody TRA-2-10; complement membrane cofactor protein; measles virus receptor; trophoblast leucocyte common antigen; trophoblast leukocyte common antigen; trophoblast-lymphocyte cross-reactive antigen |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcctcccggccgccgcgagtgtccctttccttcctggcgctttcctgggttgcttctggcggccatggtgttgctgctgtactccttctccgatgcctgtgaggagccaccaacatttgaagctatggagctcattggtaaaccaaaaccctactatgagattggtgaacgagtagattataagtgtaaaaaaggatacttctatatacctcctcttgccacccatactatttgtgatcggaatcatacatggctacctgtctcagatgacgcctgttatagagaaacatgtccatatatacgggatcctttaaatggccaagcagtccctgcaaatgggacttacgagtttggttatcagatgcactttatttgtaatgagggttattacttaattggtgaagaaattctatattgtgaacttaaaggatcagtagcaatttggagcggtaagcccccaatatgtgaaaaggttttgtgtacaccacctccaaaaataaaaaatggaaaacacacctttagtgaagtagaagtatttgagtatcttgatgcagtaacttatagttgtgatcctgcacctggaccagatccattttcacttattggagagagcacgatttattgtggtgacaattcagtgtggagtcgtgctgctccagagtgtaaagtggtcaaatgtcgatttccagtagtcgaaaatggaaaacagatatcaggatttggaaaaaaattttactacaaagcaacagttatgtttgaatgcgataagggtttttacctcgatggcagcgacacaattgtctgtgacagtaacagtacttgggatcccccagttccaaagtgtcttaaagtgtcgacttcttccactacaaaatctccagcgtccagtgcctcaggtcctaggcctacttacaagcctccagtctcaaattatccaggatatcctaaacctgaggaaggaatacttgacagtttggatgtttgggtcattgctgtgattgttattgccatagttgttggagttgcagtaatttgtgttgtcccgtacagatatcttcaaaggaggaagaagaaagggaaagcagatggtggagctgaatatgccacttaccagactaaatcaaccactccagcagagcagagaggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - interleukin enhancer binding factor 2, 45kDa - tRNA nucleotidyl transferase, CCA-adding, 1 - damage-specific DNA binding protein 2, 48kDa - splicing factor, arginine/serine-rich 17A |