Login to display prices
Login to display prices
CD46-CD46 molecule, complement regulatory protein Gene View larger

CD46-CD46 molecule, complement regulatory protein Gene

PTXBC030594

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD46-CD46 molecule, complement regulatory protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD46-CD46 molecule, complement regulatory protein Gene

Proteogenix catalog: PTXBC030594
Ncbi symbol: CD46
Product name: CD46-CD46 molecule, complement regulatory protein Gene
Size: 2ug
Accessions: BC030594
Gene id: 4179
Gene description: CD46 molecule, complement regulatory protein
Synonyms: CD46 molecule; membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen); CD46 molecule, complement regulatory protein; CD46 antigen, complement regulatory protein; AHUS2; MCP; MIC10; TLX; TRA2.10; membrane cofactor protein; antigen identified by monoclonal antibody TRA-2-10; complement membrane cofactor protein; measles virus receptor; trophoblast leucocyte common antigen; trophoblast leukocyte common antigen; trophoblast-lymphocyte cross-reactive antigen
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcctcccggccgccgcgagtgtccctttccttcctggcgctttcctgggttgcttctggcggccatggtgttgctgctgtactccttctccgatgcctgtgaggagccaccaacatttgaagctatggagctcattggtaaaccaaaaccctactatgagattggtgaacgagtagattataagtgtaaaaaaggatacttctatatacctcctcttgccacccatactatttgtgatcggaatcatacatggctacctgtctcagatgacgcctgttatagagaaacatgtccatatatacgggatcctttaaatggccaagcagtccctgcaaatgggacttacgagtttggttatcagatgcactttatttgtaatgagggttattacttaattggtgaagaaattctatattgtgaacttaaaggatcagtagcaatttggagcggtaagcccccaatatgtgaaaaggttttgtgtacaccacctccaaaaataaaaaatggaaaacacacctttagtgaagtagaagtatttgagtatcttgatgcagtaacttatagttgtgatcctgcacctggaccagatccattttcacttattggagagagcacgatttattgtggtgacaattcagtgtggagtcgtgctgctccagagtgtaaagtggtcaaatgtcgatttccagtagtcgaaaatggaaaacagatatcaggatttggaaaaaaattttactacaaagcaacagttatgtttgaatgcgataagggtttttacctcgatggcagcgacacaattgtctgtgacagtaacagtacttgggatcccccagttccaaagtgtcttaaagtgtcgacttcttccactacaaaatctccagcgtccagtgcctcaggtcctaggcctacttacaagcctccagtctcaaattatccaggatatcctaaacctgaggaaggaatacttgacagtttggatgtttgggtcattgctgtgattgttattgccatagttgttggagttgcagtaatttgtgttgtcccgtacagatatcttcaaaggaggaagaagaaagggaaagcagatggtggagctgaatatgccacttaccagactaaatcaaccactccagcagagcagagaggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: