SFRS17A-splicing factor, arginine/serine-rich 17A Gene View larger

SFRS17A-splicing factor, arginine/serine-rich 17A Gene

PTXBC028151

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SFRS17A-splicing factor, arginine/serine-rich 17A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SFRS17A-splicing factor, arginine/serine-rich 17A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028151
Product type: DNA & cDNA
Ncbi symbol: SFRS17A
Origin species: Human
Product name: SFRS17A-splicing factor, arginine/serine-rich 17A Gene
Size: 2ug
Accessions: BC028151
Gene id: 8227
Gene description: splicing factor, arginine/serine-rich 17A
Synonyms: SFRS17A; 721P; AKAP-17A; CCDC133; CXYorf3; DXYS155E; PRKA17A; XE7Y; A-kinase anchor protein 17A; A kinase (PRKA) anchor protein 17A; B-lymphocyte surface antigen; protein kinase A-anchoring protein 17A; pseudoautosomal gene XE7; splicing factor, arginine/serine-rich 17A; A-kinase anchoring protein 17A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcggctaccatcgtgcacgacacgtctgaggccgtggagctctgccctgcttacggcttgtacctgaagcccatcaccaagatgaccatcagcgtggcactcccgcagctgaagcagccggggaagtccatctccaactgggaggtgatggagaggctgaagggcatggtgcagaaccaccagttctccacgctgcgtatttccaagagcaccatggacttcatccgcttcgagggggaggtggagaacaagagcctggtcaagtcttttctggcctgcctggacggcaagaccatcaagctcagcggcttctccgacatcctgaaggtgcgcgcggccgagttcaagatcgacttccccacccgccacgactgggactccttcttccgcgacgccaaggacatgaacgagaccctgccgggggagcggccggacaccatccacctggaggggctgccctgcaagtggttcgccctgaaggagtcgggctccgagaagcccagcgaggacgtcctggtcaaggtgtttgagaagttcggggagatccggaatgtggacatccccatgctggactcctaccgggaggagatgacgggccgcaacttccacaccttcagtttcggggggcacttgaacttcgaggcctatgtgcagtaccgcgagtacatgggcttcatccaggccatgagcgccctgcgcgggatgaaactcatgtacaagggcgaggacggcaaggccgtggcctgcaacatcaaggtttcttttgattcgaccaaacacctgagtgatgcctcaattaagaagcggcagctggagaggcagaagcttcaggaactggagcagcaaagagaagaacaaaagcgcagagagaaggaagcggaggagaggcagcgagcggaggaaaggaaacaaaaggagctggaagagctggagcgagagaggaaaagagaagagaagcttcgcaagagggagcagaagcagagggaccgtgagctgcgccggaatcagaagaagctggagaagctgcaggcggaggagcagaagcagctgcaggagaagatcaagctggaggagcgcaagctgctgctggcccagaggaacctgcagtccatccggctcatcgccgagctgctcagcagagccaaggtacccgggggctccctctgcagccgccagccgcgcccgggctgccctcagtgccctcccctgaaatgcgggcggcgtcacggcgccgtttccccgccggctgcagctgtagctacgaaaccagctttaatgccgaggatgacggctccttcccgggagggtgtagcgctcgtctgtcgttcccgatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calcium binding and coiled-coil domain 2
- 5-hydroxytryptamine (serotonin) receptor 3A
- debranching enzyme homolog 1 (S. cerevisiae)
- elongation factor 1 homolog (S. cerevisiae)

Buy SFRS17A-splicing factor, arginine/serine-rich 17A Gene now

Add to cart