ELOF1-elongation factor 1 homolog (S. cerevisiae) Gene View larger

ELOF1-elongation factor 1 homolog (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ELOF1-elongation factor 1 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ELOF1-elongation factor 1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007516
Product type: DNA & cDNA
Ncbi symbol: ELOF1
Origin species: Human
Product name: ELOF1-elongation factor 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC007516
Gene id: 84337
Gene description: elongation factor 1 homolog (S. cerevisiae)
Synonyms: ELF1; transcription elongation factor 1 homolog; ELF1 homolog, elongation factor 1; elongation factor 1 homolog (ELF1, S. cerevisiae); elongation factor 1 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcgcagaaagtcaaaacgaaagccgcctcccaagaagaagatgacaggcaccctcgagacccagttcacctgccccttctgcaaccacgagaaatcctgtgatgtgaaaatggaccgtgcccgcaacaccggagtcatctcttgtaccgtgtgcctagaggaattccagacgcccataacgtatctgtcagaacccgtggatgtgtacagtgattggatagacgcctgcgaggcggccaatcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acyl-Coenzyme A binding domain containing 7
- TRAF family member-associated NFKB activator
- Morf4 family associated protein 1-like 1
- CD59 molecule, complement regulatory protein

Buy ELOF1-elongation factor 1 homolog (S. cerevisiae) Gene now

Add to cart