TANK-TRAF family member-associated NFKB activator Gene View larger

TANK-TRAF family member-associated NFKB activator Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TANK-TRAF family member-associated NFKB activator Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TANK-TRAF family member-associated NFKB activator Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003388
Product type: DNA & cDNA
Ncbi symbol: TANK
Origin species: Human
Product name: TANK-TRAF family member-associated NFKB activator Gene
Size: 2ug
Accessions: BC003388
Gene id: 10010
Gene description: TRAF family member-associated NFKB activator
Synonyms: I-TRAF; ITRAF; TRAF2; TRAF family member-associated NF-kappa-B activator; TRAF-interacting protein; TRAF family member associated NFKB activator
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggataaaaacattggcgagcaactcaataaagcgtatgaagccttccggcaggcatgcatggatagagattctgcagtaaaagaattacagcaaaagactgagaactatgagcagagaatacgtgaacaacaggaacagctgtcacttcaacagactattattgacaagctaaaatctcagttacttcttgtgaattccactcaagataacaattatggctgtgttcctctgcttgaagacagtgaaacaagaaagaataatttgactcttgatcagccacaagataaagtgatttcaggaatagcaagagaaaaactaccaaaggtagacattgcttctgcagaaagcagcatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Morf4 family associated protein 1-like 1
- CD59 molecule, complement regulatory protein
- ubiquitin-fold modifier conjugating enzyme 1
- anterior gradient homolog 2 (Xenopus laevis)

Buy TANK-TRAF family member-associated NFKB activator Gene now

Add to cart