Login to display prices
Login to display prices
UFC1-ubiquitin-fold modifier conjugating enzyme 1 Gene View larger

UFC1-ubiquitin-fold modifier conjugating enzyme 1 Gene

PTXBC005187

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UFC1-ubiquitin-fold modifier conjugating enzyme 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UFC1-ubiquitin-fold modifier conjugating enzyme 1 Gene

Proteogenix catalog: PTXBC005187
Ncbi symbol: UFC1
Product name: UFC1-ubiquitin-fold modifier conjugating enzyme 1 Gene
Size: 2ug
Accessions: BC005187
Gene id: 51506
Gene description: ubiquitin-fold modifier conjugating enzyme 1
Synonyms: HSPC155; ubiquitin-fold modifier-conjugating enzyme 1; Ufm1-conjugating enzyme 1; ubiquitin-fold modifier conjugating enzyme 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggatgaagccacgcgacgtgttgtgtctgagatcccggtgctgaagactaacgccggaccccgagatcgtgagttgtgggtgcagcgactgaaggaggaatatcagtcccttatccggtatgtggagaacaacaagaatgctgacaacgattggttccgactggagtccaacaaggaaggaactcggtggtttggaaaatgctggtatatccatgacctcctgaaatatgagtttgacatcgagtttgacattcctatcacatgtcctactactgccccagaaattgcagttcctgagctggatggaaagacagcaaagatgtacaggggtggcaaaatatgcctgacggatcatttcaaacctttgtgggccaggaatgtgcccaaatttggactagctcatctcatggctctggggctgggtccatggctggcagtggaaatccctgatctgattcagaagggcgtcatccaacacaaagagaaatgcaaccaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice