Login to display prices
Login to display prices
UBE2F-ubiquitin-conjugating enzyme E2F (putative) Gene View larger

UBE2F-ubiquitin-conjugating enzyme E2F (putative) Gene

PTXBC010549

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2F-ubiquitin-conjugating enzyme E2F (putative) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2F-ubiquitin-conjugating enzyme E2F (putative) Gene

Proteogenix catalog: PTXBC010549
Ncbi symbol: UBE2F
Product name: UBE2F-ubiquitin-conjugating enzyme E2F (putative) Gene
Size: 2ug
Accessions: BC010549
Gene id: 140739
Gene description: ubiquitin-conjugating enzyme E2F (putative)
Synonyms: NEDD8 protein ligase UBE2F; NEDD8 carrier protein UBE2F; NEDD8-conjugating enzyme UBE2F; NCE2; NEDD8-conjugating enzyme 2; ubiquitin-conjugating enzyme E2F (putative); ubiquitin conjugating enzyme E2 F (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctaacgctagcaagtaaactgaagcgtgacgatggtctcaaagggtcccggacggcagccacagcgtccgactcgactcggagggtttctgtgagagacaaattgcttgttaaagaggttgcagaacttgaagctaatttaccttgtacatgtaaagtgcattttcctgatccaaacaagcttcattgttttcagctaacagtaaccccagatgagggttactaccagggtggaaaatttcagtttgaaactgaagttcccgatgcgtacaacatggtgcctcccaaagtgaaatgcctgaccaagatctggcaccccaacatcacagagacaggggaaatatgtctgagtttattgagagaacattcaattgatggcactggctgggctcccacaagaacattaaaggatgtcgtttggggattaaactctttgtttactgatcttttgaattttgatgatccactgaatattgaagctgcagaacatcatttgcgggacaaggaggacttccggaataaagtggatgactacatcaaacgttatgccagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice