Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NME4-non-metastatic cells 4, protein expressed in Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NME4-non-metastatic cells 4, protein expressed in Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004880 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NME4 |
| Origin species: | Human |
| Product name: | NME4-non-metastatic cells 4, protein expressed in Gene |
| Size: | 2ug |
| Accessions: | BC004880 |
| Gene id: | 4833 |
| Gene description: | non-metastatic cells 4, protein expressed in |
| Synonyms: | NDPK-D; NM23H4; nm23-H4; nucleoside diphosphate kinase, mitochondrial; NDK; NDP kinase D; NDP kinase, mitochondrial; NDPKD; non-metastatic cells 4, protein expressed in; nucleoside diphosphate kinase D; NME/NM23 nucleoside diphosphate kinase 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcggcctcttctggcgctccgcgctgcgggggctgcgctgcggcccgcgggccccgggcccgagcctgctagtgcgccacggctcgggagggccctcctggacccgggagcggaccctggtggcggtgaagcccgatggcgtgcaacggcggctcgttggggacgtgatccagcgctttgagaggcggggcttcacgctggtggggatgaagatgctgcaggcaccagagagcgtccttgccgagcactaccaggacctgcggaggaagcccttctaccctgccctcatccgctacatgagctctgggcctgtggtggccatggtctgggaagggtacaatgtcgtccgcgcctcgagggccatgattggacacaccgactcggctgaggctgccccaggaaccataaggggtgacttcagcgtccacatcagcaggaatgtcatccacgccagcgactccgtggagggggcccagcgggagatccagctgtggttccagagcagtgagctggtgagctgggcagacgggggccagcacagcagcatccacccagcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 4E - eukaryotic translation initiation factor 4H - RNA-binding region (RNP1, RRM) containing 3 - serine-arginine repressor protein (35 kDa) |