RNPC3-RNA-binding region (RNP1, RRM) containing 3 Gene View larger

RNPC3-RNA-binding region (RNP1, RRM) containing 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNPC3-RNA-binding region (RNP1, RRM) containing 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RNPC3-RNA-binding region (RNP1, RRM) containing 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010697
Product type: DNA & cDNA
Ncbi symbol: RNPC3
Origin species: Human
Product name: RNPC3-RNA-binding region (RNP1, RRM) containing 3 Gene
Size: 2ug
Accessions: BC010697
Gene id: 55599
Gene description: RNA-binding region (RNP1, RRM) containing 3
Synonyms: RBM40; RNP; SNRNP65; RNA-binding protein 40; RNA recognition protein; RNA-binding motif protein 40; RNA-binding region-containing protein 3; U11/U12 small nuclear ribonucleoprotein 65 kDa protein; U11/U12 snRNP 65 kDa protein; U11/U12 snRNP 65K; U11/U12-65K; RNA binding region (RNP1, RRM) containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacaaattaatggaactagcaaatcttcagcccaaaagacctaaaacaataaagcagcgccatgtgagaaaaaagagaaaaataaaggatatgttgaatacacctttgtgtccttcacacagcagtttacatccagtgctgttaccttcagatgtatttgaccaaccacaacctgtaggtaacaaaagaattgaattccatatatctaccgacatgccagctgcatttaagaaagatttagaaaaggaacaaaattgtgaggaaaaaaatcatgatttacctgctactgaagttgatgcatccaatataggatttggaaaaatcttccccaaacctaatttggacatcacagaggagattaaagaagactctgatgaaatgccttcagaatgtatttctagaagggaattggaaaagggcagaatttctagagaagaaatggaaacactttcagttttcagaagttatgaaccgggtgaaccaaactgtagaatttatgtaaagaatttagctaaacatgttcaagaaaaggaccttaaatatatttttggaagatatgttgacttttcatcagaaacacagcggatcatgtttgatatacgtttgatgaaagaaggtcgtatgaaaggacaagctttcattggacttcctaatgaaaaagcagcagcaaaagccttaaaggaagctaatggatatgtgctttttggaaaacccatggtggttcagtttgctcgatctgctagaccaaaacaagatcctaaggaaggaaaaagaaagtgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine-arginine repressor protein (35 kDa)
- membrane-associated ring finger (C3HC4) 5
- leucine zipper transcription factor-like 1
- POU domain class 5, transcription factor 2

Buy RNPC3-RNA-binding region (RNP1, RRM) containing 3 Gene now

Add to cart