Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MARCH V-membrane-associated ring finger (C3HC4) 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MARCH V-membrane-associated ring finger (C3HC4) 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015480 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MARCH V |
| Origin species: | Human |
| Product name: | MARCH V-membrane-associated ring finger (C3HC4) 5 Gene |
| Size: | 2ug |
| Accessions: | BC015480 |
| Gene id: | 54708 |
| Gene description: | membrane-associated ring finger (C3HC4) 5 |
| Synonyms: | MARCH-V; MITOL; RNF153; E3 ubiquitin-protein ligase MARCH5; membrane associated ring finger 5; membrane-associated RING finger protein 5; membrane-associated RING-CH protein V; membrane-associated ring finger (C3HC4) 5; mitochondrial ubiquitin ligase; ring finger protein 153; membrane associated ring-CH-type finger 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggaccaagccctacagcagatgctggacagaagttgctgggtttgttttgctactgatgaagatgatagaacagctgaatgggtgagaccatgcaggtgcagaggatctacaaaatgggttcaccaggcctgtctacaacgctgggtggatgaaaagcaaagaggaaacagtacagccagagtggcatgtcctcagtgcaatgctgaatacctaatagtttttccaaaattgggtccagtggtttacgtcttggatcttgcagatagactgatctcaaaagcctgtccatttgctgcagcaggaataatggtcggctctatctattggacagctgtgacttatggagcagtgacagtgatgcaggttgtaggtcataaagaaggtctggatgttatggagagagctgatcctttattccttttaattggacttcctactattcctgtcatgctgatattaggcaagatgattcgctgggaggactatgtgcttagactgtggcgcaaatactcgaataaactacaaattttaaatagtatatttccagggataggttgtcctgttcctcgaattccagctgaggccaatcctttagcagatcatgtctctgctactcgaatcttgtgtggagcccttgtctttcctactattgctacaatagttggtaaattgatgttcagtagtgttaactctaatttacaaaggacaatcttgggtggaattgcgtttgttgccataaaaggagcatttaaagtttacttcaaacagcagcaatatttacgacaggcacaccgcaaaattctgaattatccagaacaagaagaagcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leucine zipper transcription factor-like 1 - POU domain class 5, transcription factor 2 - ubiquitin fusion degradation 1 like (yeast) - GIPC PDZ domain containing family, member 2 |