MARCH V-membrane-associated ring finger (C3HC4) 5 Gene View larger

MARCH V-membrane-associated ring finger (C3HC4) 5 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MARCH V-membrane-associated ring finger (C3HC4) 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MARCH V-membrane-associated ring finger (C3HC4) 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015480
Product type: DNA & cDNA
Ncbi symbol: MARCH V
Origin species: Human
Product name: MARCH V-membrane-associated ring finger (C3HC4) 5 Gene
Size: 2ug
Accessions: BC015480
Gene id: 54708
Gene description: membrane-associated ring finger (C3HC4) 5
Synonyms: MARCH-V; MITOL; RNF153; E3 ubiquitin-protein ligase MARCH5; membrane associated ring finger 5; membrane-associated RING finger protein 5; membrane-associated RING-CH protein V; membrane-associated ring finger (C3HC4) 5; mitochondrial ubiquitin ligase; ring finger protein 153; membrane associated ring-CH-type finger 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggaccaagccctacagcagatgctggacagaagttgctgggtttgttttgctactgatgaagatgatagaacagctgaatgggtgagaccatgcaggtgcagaggatctacaaaatgggttcaccaggcctgtctacaacgctgggtggatgaaaagcaaagaggaaacagtacagccagagtggcatgtcctcagtgcaatgctgaatacctaatagtttttccaaaattgggtccagtggtttacgtcttggatcttgcagatagactgatctcaaaagcctgtccatttgctgcagcaggaataatggtcggctctatctattggacagctgtgacttatggagcagtgacagtgatgcaggttgtaggtcataaagaaggtctggatgttatggagagagctgatcctttattccttttaattggacttcctactattcctgtcatgctgatattaggcaagatgattcgctgggaggactatgtgcttagactgtggcgcaaatactcgaataaactacaaattttaaatagtatatttccagggataggttgtcctgttcctcgaattccagctgaggccaatcctttagcagatcatgtctctgctactcgaatcttgtgtggagcccttgtctttcctactattgctacaatagttggtaaattgatgttcagtagtgttaactctaatttacaaaggacaatcttgggtggaattgcgtttgttgccataaaaggagcatttaaagtttacttcaaacagcagcaatatttacgacaggcacaccgcaaaattctgaattatccagaacaagaagaagcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine zipper transcription factor-like 1
- POU domain class 5, transcription factor 2
- ubiquitin fusion degradation 1 like (yeast)
- GIPC PDZ domain containing family, member 2

Buy MARCH V-membrane-associated ring finger (C3HC4) 5 Gene now

Add to cart