GIPC2-GIPC PDZ domain containing family, member 2 Gene View larger

GIPC2-GIPC PDZ domain containing family, member 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GIPC2-GIPC PDZ domain containing family, member 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GIPC2-GIPC PDZ domain containing family, member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036075
Product type: DNA & cDNA
Ncbi symbol: GIPC2
Origin species: Human
Product name: GIPC2-GIPC PDZ domain containing family, member 2 Gene
Size: 2ug
Accessions: BC036075
Gene id: 54810
Gene description: GIPC PDZ domain containing family, member 2
Synonyms: PDZ domain protein GIPC2; PDZ domain-containing protein GIPC2; SEMCAP-2; SEMCAP2; semaF cytoplasmic domain associated protein 2; semaphorin cytoplasmic domain associated protein 2; GIPC PDZ domain containing family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccctgaagctgcgggggaagaagaaggccaagtccaaggagaccgccgggctggtggagggcgagccgacgggcgcgggcggcgggagcctctcagcgtcccgggctcccgcacgcaggctggtcttccacgcgcagctggcgcacggtagtgccacgggccgagtggagggcttctccagcatccaggagctctacgcccagatcgcgggcgcgtttgaaatctcgccgtcggagatcttatattgcactttaaacacacctaaaattgacatggaaagactcttaggaggacaactaggactagaagatttcatatttgcccatgtgaaaggaatcgaaaaagaagtgaatgtgtataaatctgaggattcacttggtctcaccattacagataatggtgttggctatgcttttataaagagaattaaagatggtggtgttattgactcagttaaaacaatctgtgttggggatcatattgaatccataaatggagaaaatattgttgggtggcgtcactatgatgttgctaagaagttaaaggaattaaaaaaggaggaactctttactatgaagttaatagaacctaagaaggcatttgaaatagagccgaggtcaaaggctggaaagtcatcaggagaaaaaattggttgtggaagggcaacacttcgcctgagatcaaaaggtcctgccaccgtggaagaaatgccttctgaaaccaaagcaaaggcaattgaaaagattgatgatgttcttgagttgtacatgggaattcgagatattgatttagccaccacaatgtttgaagctggaaaggacaaagtaaatccagatgaatttgctgtggcacttgacgaaactcttggagactttgcgttcccagacgaatttgtctttgatgtttggggagtcattggtgatgccaaacgaagaggattatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein, large, P0 pseudogene 2
- breast cancer metastasis-suppressor 1-like
- metallophosphoesterase domain containing 1
- zinc finger and SCAN domain containing 16

Buy GIPC2-GIPC PDZ domain containing family, member 2 Gene now

Add to cart