MPPED1-metallophosphoesterase domain containing 1 Gene View larger

MPPED1-metallophosphoesterase domain containing 1 Gene

PTXBC028035

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MPPED1-metallophosphoesterase domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MPPED1-metallophosphoesterase domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028035
Product type: DNA & cDNA
Ncbi symbol: MPPED1
Origin species: Human
Product name: MPPED1-metallophosphoesterase domain containing 1 Gene
Size: 2ug
Accessions: BC028035
Gene id: 758
Gene description: metallophosphoesterase domain containing 1
Synonyms: 239AB; C22orf1; FAM1A; metallophosphoesterase domain-containing protein 1; adult brain protein 239; metallophosphoesterase domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggcgctctaggtgggatgccagcgtcctgaaggcggaggccctggccctcctcccctgcggcctgggcatggcattctcccagtcccacgtgatggccgctcggcggcaccagcacagccggctcatcatcgaggtggacgagtacagctccaaccccacccaggccttcaccttctacaacatcaaccagggccgcttccagccaccgcatgtgcagatggtggacccggtgcctcacgatgcccccaaacctccaggctacacccgcttcgtctgcgtctctgatacccactcgaggacggaccccatccagatgccgtacggcgacgtgctgatccacgctggggacttcactgagctggggctcccgagcgaggtgaagaagttcaacgagtggctgggcagcctgccctacgagtacaagatcgtgatcgcaggcaaccacgagctgacctttgaccaggagttcatggccgacctcatcaagcaggacttttactacttcccatctgtgtcgaagctgaagccggagaactatgagaatgtgcagtcgctgctgaccaactgcatctaccttcaggactcggaggtcaccgtgcggggcttccggatctatggctccccatggcagccctggttctacggctggggcttcaacctcccgcgaggccaagccctgctggagaaatggaacctcattcccgaaggcgtagacatcctgataacccatggaccaccactgggcttcctggactgggtccccaagaagatgcagcgggtgggctgtgtggagctgctcaacacggtgcagaggcgcgtccagccgcggttacatgtctttggccacatccacgaagggtatggtgtcatggcagatgggacgaccacctatgtgaatgcgtccgtatgcactgtgaactaccagcccgtgaacccgcccatagtcatcgacctccccacaccccggaactcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger and SCAN domain containing 16
- lysophosphatidylglycerol acyltransferase 1
- translocation associated membrane protein 1
- 5-hydroxytryptamine (serotonin) receptor 1D

Buy MPPED1-metallophosphoesterase domain containing 1 Gene now

Add to cart