UFD1L-ubiquitin fusion degradation 1 like (yeast) Gene View larger

UFD1L-ubiquitin fusion degradation 1 like (yeast) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UFD1L-ubiquitin fusion degradation 1 like (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UFD1L-ubiquitin fusion degradation 1 like (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001049
Product type: DNA & cDNA
Ncbi symbol: UFD1L
Origin species: Human
Product name: UFD1L-ubiquitin fusion degradation 1 like (yeast) Gene
Size: 2ug
Accessions: BC001049
Gene id: 7353
Gene description: ubiquitin fusion degradation 1 like (yeast)
Synonyms: UFD1; ubiquitin fusion degradation protein 1 homolog; UB fusion protein 1; ubiquitin fusion degradation 1 like (yeast)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttctctttcaacatgttcgaccaccctattcccagggtcttccaaaaccgcttctccacacagtaccgctgcttctctgtgtccatgctagcagggcctaatgacaggtcagatgtggagaaaggagggaagataattatgccaccctcggccctggaccaactcagccgacttaacattacctatcccatgctgttcaaactgaccaataagaattcggaccgcatgacgcattgtggcgtgctggagtttgtggctgatgagggcatctgctacctcccacactggatgatgcagaacttactcttggaagaaggcggcctggtccaggtggagagcgtcaaccttcaagtggccacctactccaaattccaacctcagagccctgacttcctggacatcaccaaccccaaagccgtattagaaaacgcacttaggaactttgcctgtctgaccaccggggatgtgattgccatcaactataatgaaaagatctacgaactgcgtgtgatggagaccaaacccgacaaggcagtgtccatcattgagtgtgacatgaacgtggactttgatgctcccctgggctacaaagaacccgaaagacaagtccagcatgaggagtcgacagaaggtgaagccgaccacagtggctatgctggagagctgggcttccgcgctttctctggatctggcaatagactggatggaaagaagaaaggggtagagcccagcccctccccaatcaagcctggagatattaaaagaggaattcccaattatgaatttaaacttggtaagataactttcatcagaaattcacgtccccttgtcaaaaaggttgaagaggatgaagctggaggcagattcgtcgctttctctggagaaggacagtcattgcgtaaaaagggaagaaagccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GIPC PDZ domain containing family, member 2
- ribosomal protein, large, P0 pseudogene 2
- breast cancer metastasis-suppressor 1-like
- metallophosphoesterase domain containing 1

Buy UFD1L-ubiquitin fusion degradation 1 like (yeast) Gene now

Add to cart