Login to display prices
Login to display prices
UFD1L-ubiquitin fusion degradation 1 like (yeast) Gene View larger

UFD1L-ubiquitin fusion degradation 1 like (yeast) Gene

PTXBC001049

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UFD1L-ubiquitin fusion degradation 1 like (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UFD1L-ubiquitin fusion degradation 1 like (yeast) Gene

Proteogenix catalog: PTXBC001049
Ncbi symbol: UFD1L
Product name: UFD1L-ubiquitin fusion degradation 1 like (yeast) Gene
Size: 2ug
Accessions: BC001049
Gene id: 7353
Gene description: ubiquitin fusion degradation 1 like (yeast)
Synonyms: UFD1; ubiquitin fusion degradation protein 1 homolog; UB fusion protein 1; ubiquitin fusion degradation 1 like (yeast)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttctctttcaacatgttcgaccaccctattcccagggtcttccaaaaccgcttctccacacagtaccgctgcttctctgtgtccatgctagcagggcctaatgacaggtcagatgtggagaaaggagggaagataattatgccaccctcggccctggaccaactcagccgacttaacattacctatcccatgctgttcaaactgaccaataagaattcggaccgcatgacgcattgtggcgtgctggagtttgtggctgatgagggcatctgctacctcccacactggatgatgcagaacttactcttggaagaaggcggcctggtccaggtggagagcgtcaaccttcaagtggccacctactccaaattccaacctcagagccctgacttcctggacatcaccaaccccaaagccgtattagaaaacgcacttaggaactttgcctgtctgaccaccggggatgtgattgccatcaactataatgaaaagatctacgaactgcgtgtgatggagaccaaacccgacaaggcagtgtccatcattgagtgtgacatgaacgtggactttgatgctcccctgggctacaaagaacccgaaagacaagtccagcatgaggagtcgacagaaggtgaagccgaccacagtggctatgctggagagctgggcttccgcgctttctctggatctggcaatagactggatggaaagaagaaaggggtagagcccagcccctccccaatcaagcctggagatattaaaagaggaattcccaattatgaatttaaacttggtaagataactttcatcagaaattcacgtccccttgtcaaaaaggttgaagaggatgaagctggaggcagattcgtcgctttctctggagaaggacagtcattgcgtaaaaagggaagaaagccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: