POU5F2-POU domain class 5, transcription factor 2 Gene View larger

POU5F2-POU domain class 5, transcription factor 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POU5F2-POU domain class 5, transcription factor 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about POU5F2-POU domain class 5, transcription factor 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029532
Product type: DNA & cDNA
Ncbi symbol: POU5F2
Origin species: Human
Product name: POU5F2-POU domain class 5, transcription factor 2 Gene
Size: 2ug
Accessions: BC029532
Gene id: 134187
Gene description: POU domain class 5, transcription factor 2
Synonyms: SPRM-1; POU domain, class 5, transcription factor 2; sperm 1 POU domain transcription factor; POU domain class 5, transcription factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccctgcgggttgacactctgacctggttgagcacccaggcggcccctggcagggtgatggtctggccggcagtcaggccagggatctgcccaggccctgacgtgtggaggattcccctgggtcccctgccacacgaattccggggctggatagcaccctgcaggccccgtcttggagctagtgaggcaggggactggttgcgacgcccctccgaaggcgccctcccggggccctacattgccctgcggagcattccgaagttgccgccgccagaggacatctcgggcatactgaaagagttgcagcaattggccaaggagttgaggcagaagaggttgagcctagggtactcgcaggccgatgtggggatcgctgtgggagctctgtttgggaaggtgcttagccagacgaccatctgccgcttcgaggcccagcagctaagcgtcgccaacatgtggaagctgcgaccactgctgaaaaagtggctgaaggaagtggaagcagagaaccttctgggcttatgcaaaatggagatgatcctgcaacagtctgggaagtggagacgggcaagcagagagcgacgaatcggaaacagcctggagaaattcttccagcggtgccctaagcccacaccccagcaaatcagccacattgctgggtgcctccagctgcagaaggatgtggttcgagtttggttctataaccgcagcaagatgggcagtcgaccaaccaatgatgcttccccacgggagattgtggggacagccgggcctccttgcccaggagcaccagtgtgctttcacctgggactggggctcccagtggatatcccccactatacacgtctctactctgcaggggtagcccactcctctgccccagccaccactctgggcctcctcagattttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin fusion degradation 1 like (yeast)
- GIPC PDZ domain containing family, member 2
- ribosomal protein, large, P0 pseudogene 2
- breast cancer metastasis-suppressor 1-like

Buy POU5F2-POU domain class 5, transcription factor 2 Gene now

Add to cart