Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of EIF4H-eukaryotic translation initiation factor 4H Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EIF4H-eukaryotic translation initiation factor 4H Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021214 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EIF4H |
| Origin species: | Human |
| Product name: | EIF4H-eukaryotic translation initiation factor 4H Gene |
| Size: | 2ug |
| Accessions: | BC021214 |
| Gene id: | 7458 |
| Gene description: | eukaryotic translation initiation factor 4H |
| Synonyms: | WBSCR1; WSCR1; eIF-4H; eukaryotic translation initiation factor 4H; Williams-Beuren syndrome chromosome region 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggacttcgacacctacgacgatcgggcctacagcagcttcggcggcggcagagggtcccgcggcagtgctggtggccatggttcccgtagccagaaggagttgcccacagagcccccctacacagcatacgtaggaaatctacctttcaatacggttcagggcgacatagatgctatctttaaggatctcagcataaggagtgtacggctagtcagagacaaagacacagataaatttaaaggattctgctatgtagaattcgatgaagtggattcccttaaggaagccttgacatacgatggtgcactgttgggcgatcggtcacttcgtgtggacattgcagaaggcagaaaacaagataaaggtggctttggattcagaaaaggtggaccagatgacagaggcttcagggatgacttcttagggggcaggggaggtagtcgcccaggcgaccggcgaacaggcccccccatgggcagccgcttcagagatggccctcccctccgtggatccaacatggatttcagagaacccacagaagaggaaagagcacagagaccacgactccagcttaaacctcgaacagtcgcgacgcccctcaatcaagtagccaatcccaactctgctatcttcgggggtgccaggcctagagaggaagtcgttcaaaaggagcaagaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA-binding region (RNP1, RRM) containing 3 - serine-arginine repressor protein (35 kDa) - membrane-associated ring finger (C3HC4) 5 - leucine zipper transcription factor-like 1 |